Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15735  (registered. 2003)
Contig Information
Length 540 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os01g0962400 [Oryza sativa (japonica cultivar-group)] >gi|20140685|sp|Q94DM8|UFM1_ORYSJ RecName: Full=Probable ubiquitin-fold modifier 1; Flags: Precursor >gi|15289926|dbj|BAB63621.1| putative Ubiquitin-fold modifier 1 [Oryza sativa Japonica Group] >gi|113535009|dbj|BAF07392.1| Os01g0962400 [Oryza sativa (japonica cultivar-group)] >gi|125529215|gb|EAY77329.1| hypothetical protein OsI_05311 [Oryza sativa Indica Group] >gi|215765210|dbj|BAG86907.1| unnamed protein product [Oryza sativa Japonica Group]
Score 394
Evalue 8.49921e-37
Total Hit Count 80
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15735
GTGATCCTCACCTCCGACCCCAAGCTCCCCTTCAAAGTGTTCAGCGTGCCGGAGGCGGCGCCCTTCACCGCGGTGCTCAAGTTCGCCGCCGAGGAGTTCA
AGGTCCCGCCCCAGACCAGCGCCATCATCACCAACGATGGAGTCGGCATCAACCCACAGCAAAGTGCAGGCAACGTGTTCTTGAAGCATGGCTCTGAGCT
GCGCCTCATCCCCCGCGACAGAGTTGGAGCGCCGGTGGCGTCTTTCTAGTCATTGTTAGAGTCAACAATGAAGAATCCTATATAACAGGAATAAAAGCAT
GTCCATGCTTGGTTGTATAATGGATGTAACATGGTTGAGTATAATCCTATGATTGACAGGATGAATATATAGCTTGCCAGACAAAAATGTATGTCGAGCC
AGTTCTGCATGGCCGGTCACACTATTGTATCGATGTTTGGTTGTTACTTCTCTCCCGTTGAGGAGATACATGAGGTTGTTGTACTTTGTACCATGTGCAC
TTCTGATTTATGGATCGTATATTCAGCAGTAAAAAAAAAA
page-top