Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15666  (registered. 2003)
Contig Information
Length 1028 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit hypothetical protein OsI_38986 [Oryza sativa Indica Group]
Score 249
Evalue 3.98532e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15666
AGAGAGCTCTTAAGAACCCACCCATGATAGCACAAAACTCATGTCAAAGTCACTACTGCTACCATGGAAAGCTTCACACTGAAGTTGAAGCATGACTGAG
AAACCACAGCAACTTCCTATTACACCTGTTGAGAAAACACATGGTCCTCCTAATGTGTCAGTTTGTCAACAGCACCACCACCTTTAATCCTGGAATATGT
TCTTCTGCCAAAAGAGAAAACAAATCCCATCTTTCAATAAAGCAAAAGCAACACACAGAGACAGAGGCGAGTCATCGCAAGTAAACTTGTGCACGCTAAA
AGCCAACCCTGCCAATCCTTTTCCAAGCTTTACACAGAGCTCCTCGTTCTCCTCCTTTCTTCAAATCTCCCTTTCAACTCTTTCAAACACACTCCCTCCC
CCCTTGTTGAGGGGAACCCCACCTGTCACTATCTACCAGCATATGCATGTTCTTCCCTCCATCTCATCTCTCAGTTTGATTTGATGTGTCATAAGTCACA
ACTCAGAGCAGAGGAGGGGAAGAACAGCTTGGGCATGCCCCCACTCTGGACGCCGAAACCCTAACAGCATGTAGCTGGGGGAAGGAAGGGCCACTAGGCA
GCTCATTAGATTCCCAGGTGGATGGCCTCAATGTTGTTTGTTGCTCCTACTTTTGAGATCCGCGAGACCTAGCTTCACTTTCACACGAACAGTTCGACCG
TATCTTCAAACAAAGGCCCGGGCCTGGCGTTCATGGATCGAAAGGGGCGGCGAGGCGATCGGACGGTTGTCTTCTAGGTCTGGGCAGACTGTGTTGGCAG
CCGGTTATGGCTGTGCTCGCCTTCGTACGTCACGATGAGCATCGCCGGCTCGTCCACGCACCGCTCGACGTGCTTCCTTCGCCGGGCAGCCCCTGACGGT
GCTGCATTTATAGTAGCCCCTCGGATGATGGGAACCCTTAATCGGCTTCTGCCCGTACTTCCGCCATGAGTATTCATCCGGAGGTATATCANATATTTTG
TTGCTAATGGGGGGCACTTTAATCGACC
page-top