Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15649  (registered. 2003)
Contig Information
Length 752 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsJ_031877 [Oryza sativa (japonica cultivar-group)]
Score 922
Evalue 1.07563e-97
Total Hit Count 209
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15649
ATTACAGGAAATAAACCTGGTACAAACAAAATAGCCGGTCCAAAATCCGTATGCAGCTACAGGGGCTAAACCAAGAACGACCTCGAAATAATGTTGAGGC
AGATGTCTGTAAACCATGTAATTTTCTACACTGCGATGAATGTGGATGTTTATGGGGCTGATTTACATCTAAGCGCCCCGACAATAATATTGGCACCATG
CGAAATTAGCCATGCTACATATTGTCGTTGGCCGGTCTATTTGACCATACAATCTCTATCTCTAGTGTTCTTGAGCCATCCTTACCGCCGTCATGGCTGA
GGCTAAAGAACCCACTGTAAACTCCCTCAGTGACAACTTTGTCGATCTGGATGGTTACTCTTCCGAGGGTTGACTTTCCAAATGTATTTTTGCTTTTGCA
CAAGATGTACAGCTTCTGCCCTTTTGGGGGGATGTCGAATAACCAAGTGAATCCCTCGTTCCATACCGGGCAGATGCTCTGGTTAACCAGCTTGGTTTGC
CTTGGAGGACCATTTCCTATTTGCAGGCAACAAAATGCATTTGTACTCCCCATTGTCTGTTTTAAGTTATTCCCACGTAAGATCGTCACTGTCAAGCAAC
CAGGCAAGCAATGCAGTAGGTTATCAGCTCTGTCATGAAAACTGGGAGGACAGGTCTTCATAAGCATCTGTAGTACAGGTATGGCCTCAGCTGAAATAAG
AGACTGGGCCTTAGCAATGTCTTCATTCATCTGGGGCCAAGATTCTTTGAGC
page-top