Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15612  (registered. 2003)
Contig Information
Length 451 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit PREDICTED: hypothetical protein [Macaca mulatta]
Score 87
Evalue 0.244906
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15612
TCCTTGTGTTGCAAACACGTAGATCCCCTGAAAGCCCTCAACCGTGAAGCATATCAAGAGGGGGAAACAGCAGACAGAACAGGAGGCATGAGGAGGAACA
CTCTCCTTGCCCTGGCGTCCTGGCTCATGCTGCTTCTGCTTGCGCTCTTCATCACAACCGCCACTGCTTCACTGCCGTGCCAGTGCTGCTGGATCGTGCA
GCATCCGACGAGGACCTGCGGCCACGCCTGCTGCGGCAACAACTGCTGCCCGCCCGCTCCACCGCCATCCGCAGGCTGAAAAAAATGATGCACAGGCTTG
TTCATCTGTAATACAGAAGCAAAAAATAAAAATAAAAATATTCCAGAGGGAATGGTGTTGTACTTATACTTACCTGCTCTTCTGTGAGCATGTAATAGTC
TCTATTAGTTTCCAGAAATAAACATCTCTTGGCTCCTACAGAAAAAAAAAA
page-top