Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15556  (registered. 2003)
Contig Information
Length 783 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit succinate dehydrogenase subunit 4 [Oryza sativa]
Score 551
Evalue 1.23105e-54
Total Hit Count 53
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15556
TTTTTTTTTTGCAACAGGTAAACATGGCATTTACTAATTTTTTTGCAGAACAAGAGCAATAAACGACAGAACGTCAAGGGTTGATATATACCATTATTAC
AAAACTAGGGCAAACGTTGCTCCCATATAAGCTAGTACTCTGTGACAACTGGACATTACTTGTCCATTAATCAATCACAGAAATAATAAGAGGAAAAAGA
AAAACGCAGCAACTTGGTATGCGAGACAGAAGAAGAACCAGCGGTCGGGCATTTTGTCCACCTTGACGATTATTCCAGTGTACAGATAGGCGGGTTCCTG
GTGGCATCTCTCGAGAAACTACTACCATGGAGGCACTTAGAACAGATCAAAGTAAACCATCGTGTCCTTGGCCATGACTAGCAAGAGCAGCTTGAAGTAT
ATCAAGGCCCACTTCCTGGTGATGTCGTGGTGGACGTAGTCCAGGAGGATCTCCTTGTGGAACATGTAGACCTGATGGTACACTGACGCGATCAGGAGAG
AAGTGCTGATGCTGTTCTTCGACACCAGGAGCAGAGTAGGGATCATGTAGAACGTGACTTTAGTCATCATCTCAGTCCGCCTCACTTTCAAGCTTTCGAG
TGTCAATGGACTGCTTCTGGGCTTGCTAATGGTTGCTTCAATGGGGCTGAATGCTGCGACCTTCGCTGAGGCTCCCTCCTGTGATTTCAGTGCATCCGAT
TGTACCATCCCAGCAACTGTCTTTGAGGTCTGCTGATCAGATCCATTGGAGGCTCCAGTAGAAAACCAGCGAGGCAATACGTG
page-top