Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6885  (registered. 2012)
Contig Information
Length 988 bp
Clones alternative view 55 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 4
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|399414|sp|Q03033.1|EF1A_WHEAT|EF1A_WHEAT RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha
Score 610
Evalue 1.00E-172
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6885
GGCACGAGGCCGACCGCCGCCGCCGCCTCCTCGTCCTCTCGGTCCCCTCTCCTTCCTTCGAGTTTGCTTCAGCCATGGGTAAGGAGAAGACTCACATCAA
CATCGTGGTCATTGGCCACGTCGACTCTGGCAAGTCGACGACCACTGGCCACCTGATCTACAAGCTTGGAGGCATTGACAAGCGTGTGATCGAGAGGTTC
GAGAAGGAAGCCGCTGAAATGAACAAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGAGAGGTATCACCATCGATATTG
CCCTCTGGAAGTTTGAGACAACCAAGTACTACTGCACCGTCATTGATGCCCCTGGTCACCGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAGGC
TGACTGTGCTGTTCTCATCATCGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACACGTGAGCACGCCCTCCTTGCTTTCACT
CTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGACGCCACCACTCCCAAGTACTCGAAGGCTCGTTACGAAGAAATTGTTAAGGAGGTCTCTT
CGTACCTGAAGAAGGTCGGCTACAACCCTGACAAGGTTCCCTTCGTCCCCATCTCTGGGTTCGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGA
CTGGTACAAGGGCCCAACCCTGCTTGAGGCACTTGACCAGATCAACGAGCCCAAGAGGCCCTCAGACAAGCCCCTCCGTCTTCCCCTACAGGATGTTTAC
AAGATTGGTGGCATTGGAACTGTGCCTGTTGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTTACCTTTGGTCCCACTGGTCTGACAACTG
NNNTCAAGTCCGTTGAGATGCACCATGAGTCTCTCCTGGANNCGCTTCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTTGCCGT
page-top