Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15379  (registered. 2003)
Contig Information
Length 973 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 1
Homology (BLAST) Top Hit Os05g0105600 [Oryza sativa (japonica cultivar-group)] >gi|46359911|gb|AAS88843.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|52353604|gb|AAU44170.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113577963|dbj|BAF16326.1| Os05g0105600 [Oryza sativa (japonica cultivar-group)] >gi|215697558|dbj|BAG91552.1| unnamed protein product [Oryza sativa Japonica Group]
Score 642
Evalue 2.02279e-82
Total Hit Count 404
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15379
TCATTTGCTGGTTCATCCTTCTTGTCAACCAAAATATTCCATCAGCCACATACAACCAACCAAACGGACACACATGGCAGTCACCATAAGATTGTTGTAC
CGATTTGTAAAACTATCTTACCCCGACGACGGAAACTAGATATATATGGTATGTGTTTACCGGCAAACTATATATGGTCCATACAAAGTACAAACATTCT
ATAGCATATTTCAGGTTAACTTGTGTAGTAGCGCCCACTCGCCGGATCAAACGTTTCTCGTTCGACCGCGTCAATGGCTCGTTAATTTTTTTGCGACATG
GTGAAGAACCATCCGGATTAGTCCCAAGGCTCGTGGAGGTTCAGGCTCTCCATGTTCGCCTCGATGTCTCCCATTGATTTCAAGTCATCTGTTCCAAAGT
ATGATAGTCTGGCTTCATGTAACGAGTCTGCATTTATTCCCTTGCGTGCACAGCGAGTGTTTTCCTTTTCTTCATAGAAGTCAAAGTCATCCAGAATTGA
TGTTCCATGGCGATAAGCCTTGAAAATTTTCAACACTTCCAGACCCTGGGGAAGGCCAATCTCTTGAGTATCCCTGCTGAATGTAACAGGTCTGTTGTCA
TTATTTTCTAGAGTGATATGTTTGAAGAGCCTATTCGGAATGTCCTTTACAATGTGCCAGACAACAGGGAAAAAGCCATTCCATTTATTTTGTTGCCAGA
AGTCCATGGTCTTCTTGAAATCAACAGGACCTAACATCTCAGCCAATCCTACAAACTGCCCACTGGTATTAACCGAAAACAAGAGGAAGACAGGACATTT
TGTACCCTTTTCCTTCATTAAAAATCTGGGCATCATGGAAAAGCGGTATCCAGCCTTACTGGTTCCCATTTGGTGTACTTGCCCAAACATTGTATTTGAT
ACCTTTATGAATATCATCTTCACTATATGACTTTATCATGAAGAACTTGGCCTGTTCATACTGAATGAAAAGT
page-top