Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15361  (registered. 2003)
Contig Information
Length 948 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit Os02g0167700 [Oryza sativa (japonica cultivar-group)] >gi|49387757|dbj|BAD26245.1| putative TIP120 protein [Oryza sativa Japonica Group] >gi|113535539|dbj|BAF07922.1| Os02g0167700 [Oryza sativa (japonica cultivar-group)] >gi|215697277|dbj|BAG91271.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218190138|gb|EEC72565.1| hypothetical protein OsI_06001 [Oryza sativa Indica Group]
Score 925
Evalue 1.5805e-99
Total Hit Count 172
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15361
CAAGGTAGCAAAGACGCATGATTTCAATTCTTCAATTGCCACACCCACACCAGCTTCCAATGGTCTAGCACCATATTTTGTACAGAAAAAGATATTCAAC
ATCCTTTTCTCTGCATGGTAGTTACCGCACGACCACATTTCAGCCAAAATCGGTACAGTATAATCTACTATCGCAAATTTAGGTTGGATCATCGCCTCGA
AACCGGCAGGCCAACTTGACTCGCCTATTTCCTAACATATATACAGAAAAATATTCAGCACTCATTCGCTGCGCACCGAATTGTACTTCTCGGCAAGTGA
AGGGGTGGCCGTTATCTTGCTCATCAGATTCTTCAACTTCATGCTGTAGTCGCTGCCACTTATGCGGTTTACAGCAGCGATTGCTCGAAGAGCACTGCGA
ATCAAGTCTTCGTTGCGATCAATCTCCTGCTTCACTGCGTCGCTCTTAGGTTTGTGACCGATGGTTTTCTCAAGAGGTTCAACTAGCGAGTCCAAAACTG
CAAGTACAGCAGAAGGGCACTTGTCTGCTAGCTTCGAGAGAATCAGATGGCAGGGCATTTTCACATCATAATGATCACCTAAGCCAGATAAGAGGAAAGG
AACGATGAAGGACGACGGATTCACTTGATCAAGACAGTTATCGAGCAATGTGTCAATACATTCAAAGGCAGCTTTCCTAAGCTCAAGCCCATCATCAACG
ACATGCTTGAAAGGCCCTAGATCAACGGTCCTGATCAATTCTTGCTTCACGACAGTCTGGTCATACAAAAGAGGCAACAATTCAGGAAGAAGACCTTTGA
TCAAACTTGGCTTGTTATGGGCAGCTGTACTCAACGCAAGGACAGCTGCACGTCGCACATGCCTGTCACTATCTTTAATTAACATAAGGGAAAGTAGAAA
TCTCCGAGTACAAGATTGCATCTATCTTTCCCAGTCCGGTTCAACGAT
page-top