Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15327  (registered. 2003)
Contig Information
Length 882 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit Os02g0816600 [Oryza sativa (japonica cultivar-group)] >gi|113538045|dbj|BAF10428.1| Os02g0816600 [Oryza sativa (japonica cultivar-group)]
Score 992
Evalue 1.09673e-105
Total Hit Count 171
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15327
ATTGGTTAATCTGCATATATGCAGGCATAGATTATATACATCATGTTTCTGTACATCATTCTATCATCTTGTATGTGTGTGTTGTTTGCATGAAAGGAAA
AGGAGAAATAACTCTTTAATTTCCTGTCAAAAGAAGAAGAAAACAAAAACTAAAAGCGCTTCACAAAAATGATTCCCGGATCACCCGTGCGAATACACGT
GATGACAACCGGCTCAAGACATCTGGTAGGATCTTCGACGTGATGCTCGGCAACACGGGTAGAAGCTCTTGCACCAGAGACACGACATTTACGTCCCCGT
TGACTGTTGGATTTGCCGTCCCAGCCGATAGAAACTTGACGACCTTCTCGACATTGTTCAAGATGATCCTGTCTTCCTCTGTGATTGTAGGAAGCAATGC
TCCGGACCTCACAGGAACCATGCCGAAAACCGGGACGGGATTTCTGACCCCGAAAGATGAAGCAATTTGTAGCAACTGCTCCCTTGAAACCGCGTCGATG
GCTTTCACAATCTCGTCAAGAATGAACTCCCGGAAGAAGTCACCCCTGTCAGAGAGTAGAAAAGAGAGAGCCGCCCGAGCTTTGATTGGGTTCTCCGGTT
GGGAGATGGCCATTGGGAATGCAGGAACTAAACTGGTGCTAGGTTGGAATCCTATAGCACCCAGCTCAGCCATGTTACCCTTCATGTCCTCCCCACCACC
GCTCTTTGCTGCACTAATGAAATTCTCGAAAGCTTGCATCACGTCAATGAACCTCTCTGCGTCAAAGACACCTGTTTTGCCGTATATTGTGTAACGCAAG
GCACTCCTTAGTCGAGGTGATTCATCCGTTAGCAGCCTCTGTGCAATATATGGATATGCTTCATCCACAATGGGCAAATTCA
page-top