Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15245  (registered. 2003)
Contig Information
Length 1257 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit Os03g0355900 [Oryza sativa (japonica cultivar-group)] >gi|108708218|gb|ABF96013.1| NAD dependent epimerase/dehydratase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548609|dbj|BAF12052.1| Os03g0355900 [Oryza sativa (japonica cultivar-group)] >gi|218192848|gb|EEC75275.1| hypothetical protein OsI_11606 [Oryza sativa Indica Group]
Score 1068
Evalue 2.91619e-114
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15245
ATATCTCCCCTCTCGCTCTCGCCTCAAGTTTCCAGAGCCCCCCTCCCCTGGTCCCCCGCGGTCATCTCCAACAATGGCGACGGCTCACCTCAGCCCGGCG
CTCGCGGTCTCATCGTCGCGCCACCCAACCTCCAAACACGGCCAGCCGCCCGTCTTCGCGCAGCCAGGCGGCACAGCGGTGCTGCGGTCTTGCTCGCTTC
CCTTGTCCTCGAGACTCGCCGCATCGGGTCGAGGTGGGTGGCGGTTCGCGGCGGCAGTGGAGCCCAGGACCGCGCAGCAGGAAAAGGCCGAGGCCTCCTC
GAGGCTGGTCCTCGTCGTCGGCGGAACCGGCGGCGTAGGTCAGTTGCTGGTAGCATCTTTGCTGAGCAGGAAAATTAAGACAAGGCTGCTCCTAAGAAAC
CCTGAAAAGGCAGCGTCCTTATTTGGCAAGCAGGATGAGAGTGTTTTGCAGGTTTATGAAGCGGACACGAGAAATGCTGACGGTTTGAATCCAGAAATGT
TTGAGGGAGTTACACATGTGATCTGTACTACTGGGACTACAGCATTTCCATCAAAACGCTGGGATGGGGATAACACTCCTGAACGTGTCGATTGGGATGG
CGTCCGAAATTTTGTGAGTGCCATGCCACAGACGGTCAAGAGACTGGTTTTGGTGTCATCGATTGGTGTTACAAAATATAATGAAATACCATGGAGTATT
ATGAACCTCTTTGGTGTGCTTAAATACAAGAAGATGGCAGAGGACTTTGTCCGCAATTCAGGCATACCTTTCACGATCATCAGGCCGGGGAGATTAACAG
ATGGGCCCTACACTTCCTATGACCTGAACACACTTGTTAAGGCTACAGCTGGAGAAAGACGAGCAGTTGAGATAGGCCAAGGTGACAAGCTTGTGGGAGA
AGCGAGCAGATTGGTGGTGGCAGAAGCATGTATCCAAGCTTTGGATATTGAATCTACCCAAGGAAAAATATACGAGATTAGTTCGGTGAAGGGCGAAGGA
CCTGGGAGCGACCAGGAGAAATGGAAGCAACTATTTGCAGCTGCTGAATCGAACTAGTGGCACTCTGAAGCACAGAGTGCAGTGCATTTTAATTTATATA
CACTGTAGTGGAATTCCATACAAGGGCAGTAGCGGTCCAGTACATACATAGGTGCAGAGTTGTCATTGTCGCGGGATTTGGAAACGACTCGCAAACAATC
GAGCATAGTACTATGTGCCTTATCCAAGCTATGCGCTCAGGCTTAAAAATGGAGAAT
page-top