Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6866  (registered. 2012)
Contig Information
Length 828 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242084370|ref|XP_002442610.1|| hypothetical protein SORBIDRAFT_08g022930 [Sorghum bicolor]
Score 309
Evalue 2.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6866
TTCATTTGTCCATACCCATGTCATTGAGTAATACTCAATCACTACTACAGACCAAATTGGCTAACATTTTAAGCGCCAGTCTATGATCATGTGATAGATA
CATCTCCATTTCTTGACTGGTATGTACAAGGCACAAGCAGAATTGCCCCAGCCAGATCTTGTTTGCTAGACAGCAAGACCTGCAACAAGGTCTTGGGTAC
AGTAATCTTACAAGCACCATTCTGTGAGGTGTGTTCTAGTTGGAAATCTGACTCTCACTTGCTACACTTGTGTAAATTCCAACGCATTTCCATCCGGGTC
TCGTGCAAAGATTGCTGGTCGCCCGGATTTGCTGAGCGTGTAGCTGATTCCAGCTTTGTCAAAGATTTCTTTCAACTTCAAGACATCTCTGATTGCTATA
CAGGTATGACGATCACGCCCGCCATGCTCTGGGCGTCCTGTCAGTGGATCCGGATTTGGCAGCTCCATCAAGTGGATCATCTCAGAACCAACCCAGAGCC
AAGCACCTCTGTACGGAAGCTTGTCATTTGGCCTAGCAGGATTCACCTTAAGACCAAGGAGGTCCTGGTAGAATGCCATCGACCTTTCAAGATTTTCACA
TAGTATTCCAACATGGTGCATACTAACAACTCCATAGTCAGGTTCCTGGGACTGCTCCTTGGCCGTCAGGGCCTGCTCACCGCCGGTGGCCACCGACATG
TGAGTCCGGATCCGGCGGTGTGCGGCAGCAGAGGGAGTGTGATGCGTTCTGACAGCAGCGCAGGCCTTTCCGGAGCCGGATGCGGAGAGGAGAGGGAGAG
AAGAGAGGCACCTCATCGCCATTGTGGC
page-top