Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6864  (registered. 2012)
Contig Information
Length 973 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|42761388|dbj|BAD11656.1|| lipid transfer protein-like [Oryza sativa Japonica Group]
Score 228
Evalue 6.00E-58
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6864
TTTTTTTTTTATCCACGAAATAAATATCAATATAGCTCTGTCGTGGTTAAGCATCTGCCATCAACACATGGCGTTTGCGTACCAGATTTTGATTAAAACA
AGAAGAACATAACCACACTTTTTCAGGATATTACTGCAAACCATCACTTCCACATGAAGAAACACAAGTCTCAACTCTCCATCTACTTATCTGGGGTAAA
ACAACAGTACGTCATCCGAACGAATCCTTTTACCACGTGAGTAGATATAGACCATCTAAAGCATCGTCGTTGTGTGGGAACTTGCAGAGTTATGGAAACA
AACATGAAGGATAGAAGAAAGGGAGAGGATAGAAGGGCGTGTGCTTGTCCGAAAATCAGAAGATGGATGAGATGAGAGCAGAGACGACGGCCGCCGCCAC
GACGCCGTAACCGAGCCCCGTCGGAACCTTGAAGCCGTCGGCGGTGTCTCTCGCCGGTGCGGCAGTGGACGGAGTAATCTTGGAAGCATTTGCGAAGAGA
GCGTAGTCTGGCGAGCTCGGGGTCAGGTGCAGCAGGTTGATGCAGAGGGAAACGTTGGCGTTGGGGAGCTTGCAGGCGGCGGGCTGGGCCAGGAGGCGCT
CGAAGCGGAGGCCGAGCTGCTGCACGCCGTGGCTGCCGCTGTGCACCTGCTGGATGATGGAGCAGAGGCACTCGGGCCGCGACTTCTGCGTGTCCGCCGT
GTCCTCGCAGCACTTGGCCGACGGCGTGTCCTCGTGCCCCGTCGCGTAGTCCATGCAGTCCGACAGCTTCTGCAGGTCCTCCTGGCACTTGGTCTGCAGC
GCGTCCTGCGCCACCGACGTCGACGCCGCCATCGACACGGCGAGCAGCACCGCCGCCAGCTGGCACCACCGCGCCATCTCTCGGTCGATCGCCGGCTGGC
TAGGTTAGGTCCCTTCTTTCGTTTGGCTCCGCTTCGATCTGTGCTCGGTTCTGAGCTGCTGTAGCTGGCTAGC
page-top