Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15202  (registered. 2003)
Contig Information
Length 1398 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit hypothetical protein OsI_18854 [Oryza sativa Indica Group]
Score 971
Evalue 5.99635e-103
Total Hit Count 393
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15202
GTTCCATGTATATTACATATGGATTCTCTTAAAGGAAATCACAGTGGACTGAAAGACATTATTCAAAGTTATCTATGGGAAGAGTGGAAGGAAAGGCACC
CTGAATCAGCATTAGATATTTCAGACAAATTCTTAAATCTGAGATTCGTCTCCCTTGAGCTCCCTCAGCAAGATAACTCATTTGACTGTGGCCTGTTCCT
TCTCCATTATGTGGAACGCTTTCTGATGGATTATCCCAGTAGCTTCAACCCTATGAAGATATCAGTATCCTCAACCTTTCTCAGTGATGGTTGGTTTGAA
CCCGCTGAAGCTTCTCTGAAGCGTTCATTGATCCGGAAGTTAATCCAGGAGCTAGTGACAGTACCTTCTCAAACTTTTCCGGAACTAACCTGTGGTAGCG
AGCAGTTTGATGAAAGTTATCTAGGAAGAGAAAATGCTGAGCCTGAAGCAGCTAGAGAGTTCCTTGCTCAGGGGTGCTCTGCTGGTGAATCTGACTCACT
TTGCCAAATTGCTGGAACACAGCAACAATCCACATCCATCTGCTTTAATGATTCTGGAAATGTTCTACCTGTTCCTGGATGCATTTTAGAGACTGAAGGG
GTTACAACATTTGCTGTACAGGACACACAGGTTTGTCCACCCGACAATGATATTGCCATCTGCATGCCAAGCCAGGCTGTTGAAAATGAGCCACCTCCTG
CGGATTATGATAATAAACCTGACCTGAGATCATGTGCCCCAGAAGATGCTGAAGCGTTGAAGGATGATGGTTGTGTGGTAAAAGGTCAGGACACTTTTGA
GGAATCCATGCTGGATTGTTCGCATAATAACCAGACAATTTCTAGCCACGCAGAAGTTATGATGCATGATATTATGGATTCCAAGTGTGGCTCATTCTCT
ATTAACTCCGCGGCAATGGCCTACAAAGAACAGAGCTTAGAAACAAACATAAATGAAGTTCTGTATGATTGCTGTGATGTTTCCGAGGATATGGATCCTG
TCATGATGTCTGATGCCAGGGAAGTTGACATTGCACCTGATCCAGCAAGCACCAAAGACGAAGCTGACAATGGCAGATGTGATCTCCCGGATGTCATGGG
ATCTGTTGCGGCTGGTGATATAGAAGGGAATACTTCTGAGCATTCTTCAGAAAGAAACATTATTGAAGATGAGGAGGCCAAGGGTGATATTTCTCTCATA
GTATGTGATTTGAACAATGATGTTGCTGAGCAGTCTTCACCCGTGGTATGTGATTTGAACAATGATGTTGCTGAGCATTCTCCCGCAACAATTGCTGTCG
AATCTGAGGACGCGAAACATGAAGAGACTTCTGTGGATCTCAAGGTAGAAGATGATATCGAAGTTGGCATGGAGGAAAACTTGCGCCGCTGCGGATAA
page-top