Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6856  (registered. 2012)
Contig Information
Length 2157 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 5
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 4
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XN Leaves, plant was grown at constant 23℃ 6
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218199136|gb|EEC81563.1|| hypothetical protein OsI_25004 [Oryza sativa Indica Group]
Score 1124
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6856
GATAATACAAATTTGTGAAAAGACGCAGAGCACTATATCATCACTGGAGTTACAGATACCGTGTGACCGTCAACAAGGACTGGACTTGTACAGCTCACAA
CAATAATATACAGAAAAAGCATCATCAACAACTCGCACCTAGCAACAACTGCAGAACCAAGCAATCCACTAGCTATTTGACTGTATAGAGCACCTAGTGC
AAGAAAAGAAAAACAGCCTCCTTATCTACTAAAAGGTGATGGTTCGTTGGGTCATCTCTGCACAAACTTTATATATCCAGGGCAGAGTGCGCGGAAACGC
TAGCTTACAGGCTCCGTCATTAACTTGAGCAACCAGTCCTGCCATCATATGGTACACGATTTATTCAAGCAGCAATTTCACTTTCAGCCACTTGCTTGTG
GTATTGCATGGCAGGACGTCGCTCCCGCTTCTCACAACTGTCTAGTTGTAGATCTTTACAGGCCTCTCAAATGAATGGCGGTTCTGGTTAGCACTATGTG
CCTTTCTTGGCGCTGTGTCCGGGTGCTCCAGTCCAAGATACTGCTCCCAAGCTCCATACATGTTTCTCTGAAATCTCGTAGCTACAGTGTCAGAATCTTC
AAAATAGTCTGGGCGACCAAGGGATATGTACGCAAATTTCCACTTGGAGAAATCCTCATCTGAGACCTTAAGCTTTTTCTGTAAACGTTCTTTAATAGAA
GATAAGGTCTCATCCTCACGAATAACCATAAAGAAAGGTTCTCCAAAATTCTGAACTTGCGTTTGGTTTTGAGTGTCTTTGGTAAAATGGTATACATGAA
TCAAGCGATCAAAAGGACCAAGGTTTTTCTCCTCCTCCGGTACCTCCTCTGCACGCAGTGTCCAGTACTGATCGTTGATGTTTTCTATCTTTTCACTGGG
TGCAAAAATCTTGTATATCTTGTGGTAGAAAACTTCAAGTAATCGAAGTTCAGCATCAGGATGAGACAGGTCAACCTTTGATTTGATATCACTTAGAACA
TCACCAACCGTGCTATTTTTTGGCAATCTTATACTGTGAACAGACACCTCATCCTTGGTGGCATGATGATATGTAACTTTCAATGTCTTCAATGCTTGTA
GTTCTGGCAGGGGTATATCCAATACTTCATAGTACAGAATATCAGAAGTCTGATTGTAGTGAATCAGCATATCTAGCAAACGTTCAACGCCTCTGTACTT
AATGGGTTGAGGCTTAGGCTGTTGAGAGTAACAATTATGTGATGTAAGACGAATTTTTGATGGGTCATCAACACCAAGCTGTTGAGCGACTTTTTCTACA
ACTTCATCGTACGTGAAAATCTTTGACATCTCTAGGCAAAAATCATCCTCCTTGGGCTTCTCCAACGACCGGAAGTGGACAACCTGTCTGTTACGTATAT
ACACCAGAAACGATGGGACATCAGGGTATCTAAACTGGTCGGCAGTGTCTGGCTTTGGGGATTTTTGAAAACAAACAATATCACCATCTTCCAGCTGGCA
AGAGCGAAATATAATCCTATTATCAATGTATTCACACATCACATTTGGCTCGAACTTAATTTCCTCGTAAAGTTCAACATCATCATCTTGCAAAAAACCA
GCCATTTTTCTCAATTTTGGCAGAATATCCTGTGGTCTTCCTGAAGCCTTCACAAAGAGCCTACCAACATACCTCAGCTGTTCCTTCTCAGGATCATAGA
GTTTGAAGAAAAGCAAAATATCCTCTCTGGTCTTGTCTGGTAGAGTAAGAGGTTTTAGGTCCAGCCCAAGTTCAACTTCCAAGAACAACTTCAGTTCTGC
GTTGTGGGCCTTGTTTGCTGCTTCCTTTAATTGCCCAACAGTTAGTGCTTCTTCTTGAGGAGTCAACGGTCGATTGGGTCGGTAGGTATGGTTTTGCCGC
TTGGCCCACAACCAAAATCGTTGAAACTGCGTAGGGATGCCCAATTCTTTTGCTACCTCCTCCTTGAATTGAGTAAAAGGCATCTGCTTTTGAATACGAA
AGCTCGGGACTTTATCATGATCAACAAGATCAAAATATATATCTTTCCCTATCTGAGCAGTCAAATCGTCATCCCTAGCAACCTTAATGATGGTATATAG
GTGGGCCTCAGCTTTCTCCTTTTTCCGGCGCTCCTTCTCTTCACGGTCCTTTTCCAG
page-top