Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15119  (registered. 2003)
Contig Information
Length 721 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsI_02953 [Oryza sativa Indica Group]
Score 370
Evalue 1.01696e-33
Total Hit Count 96
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15119
GGAGACTTATATTTCCCAGATCCACATTTGGCTCAGGTCTAGTGTACCAAACGGGCAGCCCAAATGGCTTCTGTCTTTCATACCGGGTTACCCGATGCTT
AACTTCATGCTAACGACATCAATCTATCTTTTGCTATCATACCGGGTATTTGAGATCACAAACGTGTTGAGGGCAGCCTTCATTCCTAGCAGAGATAACA
ACCGCCTGTACCAGAATTTCGTTGCCGGGGTTGTCATCTCTGTATGTCTGTATTGCTGCTCACTCGTTCTTCTAAAAATTCCGGCTGTATAGATGAATAG
TTCTTATGGATGTAGAATTGCCAAGTAAATGATACCGGTGGAAGGCTGCTTCTTCCACACGCACAAACGAGGTTTGCTTGGCGGGGATGCCCGGTCCCAT
TTGCATCTAGGGGCTCCCCTAAGAAGCTGCCCTTGGGAACTTGATCGCCGTGGAGGGAGACGCAAATTTTTGATCATTTTTCTTGTTGTAAAAGCCAACC
CATTCTTCTGGGAGTTGTAACAGCTGTCAGCCGTGTAACTGTCAACTTTGGTGTGCACCTTGTTGTTTTGTAACCTGTCTTAGATATTCTTCTATACATA
CAAGGAAAGCGTTTCCCTCCTGTAAAAAAGAAATAGCGAGTCAACGCATGAACTGTGAAGCATACCTTGTCGTGCTCTGAATTATTTTCGAGTTATTTGA
GAAGGGCAAATGGGAAAGCAA
page-top