Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6853  (registered. 2012)
Contig Information
Length 1129 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|146760217|emb|CAM58984.1|| beta tubulin 6 [Hordeum vulgare subsp. vulgare]
Score 721
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6853
ACTCTCTCCTCGCCGCCACACTCCTCACTCCCCACTGCGCTTTCTCGTCGCGCTCGCCACTCAGAGAAGATGAGGGAGATCCTGCACATCCAGGGTGGGC
AGTGTGGAAACCAGATTGGTTCCAAGTTCTGGGAGGTGGTGTGTGATGAGCATGGCATCGACCCCACCGGGCGGTATGTCGGCACCTCTGACCTGCAGCT
GGAGCGTGTCAACGTCTACTACAATGAGGCCTCATGTGGTCGCTTTGTGCCCCGTGCTGTCCTTATGGATCTTGAGCCGGGCACCATGGACAGTGTCCGT
ACTGGACCGTACGGGCAGATCTTCCGCCCTGACAACTTTGTGTTTGGGCAGTCTGGTGCTGGTAACAACTGGGCCAAGGGTCACTACACCGAGGGTGCTG
AGCTCATTGACTCCGTTCTTGACGTTGTCAGGAAGGAGGCTGAGAACTGTGACTGCCTTCAAGGTTTCCAAGTATGCCACTCTCTTGGTGGTGGTACTGG
ATCAGGCATGGGGACCCTTTTGATATCAAAGATCAGGGAGGAGTACCCTGACCGCATGATGCTTACGTTCTCTGTTTTCCCCTCACCGAAAGTATCTGAT
ACTGTGGTTGAGCCTTACAATGCCACTCTTTCGGTCCATCAGTTGGTTGAGAATGCAGATGAGTGCATGGTTCTTGACAACGAGGCCCTTTATGACATCT
GTTTCAGGACTCTCAAGCTGACCACTCCCAGCTTTGGAGATTTGAACCATCTGANNNNNGCCACCATGAGCGGAGTGACCTGCTGCCTGAGGTTCCCCGG
CCAGCTGAACTCCGACCTCCGGAAGCTGGCGGTGAACCTGATCCCCTTCCCGCGTCTCCACTTCTTCATGGTCGGGTTCGCGCCGCTGACCTCGCGCGGC
TCCCAGATGTACCGCTCCCTCACGGTCCCGGAGCTGACCCAGCAGATGTGGGACTCCAAGAACATGATGTGCGCCGCCGNCCCCCGGCACGGCCGGTACC
TGACGGCCTCGGCCATGTTCCGCGGCAAGATGAGCACCAAGGAGGTGGACGAGCAGATGATCAACGTGCAGAACNNGAACTCGTCCTACTTCGTGGAGTG
GATCCCCAACAACGTCAAGTCGAGCGTGT
page-top