Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15066  (registered. 2003)
Contig Information
Length 770 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os08g0559400 [Oryza sativa (japonica cultivar-group)] >gi|15076665|dbj|BAB62328.1| cyclophilin [Oryza sativa Japonica Group] >gi|15076667|dbj|BAB62329.1| cyclophilin [Oryza sativa Japonica Group] >gi|45736107|dbj|BAD13138.1| cyclophilin [Oryza sativa Japonica Group] >gi|113624471|dbj|BAF24416.1| Os08g0559400 [Oryza sativa (japonica cultivar-group)] >gi|125604327|gb|EAZ43652.1| hypothetical protein OsJ_027135 [Oryza sativa (japonica cultivar-group)]
Score 821
Evalue 5.81862e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15066
CCTCGTGCCGCCGTCCCCCTCTGGCTCCCTTTCCCTTTGTCGCGCCGCCGCCACCGTCTCTTGTCTCGCCTGTCGCCACCTCAAGATGTGGGGCGGCGAC
GACGGAGGGACTCCGGAGGTCACCCTGGAGACCTCCATGGGCGCCTTCACCGTCGAGATGTACCACAAGCACGCGCCCAAGACCTGCAGGAACTTCGTCG
AGCTCGCGCGCCGCAAATACTACGACAACGTCGTCTTCCACCGCATCATCAAGGATTTCATCGTGCAAGGTGGGGATCCTAGTGGAACAGGCAGGGGCGG
CGAATCCATCTACGGAGCAAAATTTGAGGACGAGATAAGGCCAGATCTGAAGCACACCGGGGCTGGGATTCTATCAATGGCAAACGCTGGTCCGAATACA
AACGGGAGCCAGTTCTTCATCACTCTTGCACCTTGTCAATCACTGGATGGTAAGCACACAATTTTTGGGAGAGTATCCAGAGGAATGGAAATTGTTAAGC
GCCTTGGAAGTATTCAGACCGACAAAAATGATAGGCCCATCCATGAAGTGAAAATCCTGCGGACTGTTGTTAAAGATTGAAGCACGGCTGTTGTCATGGA
ACTCTTAATCTTTGGTTGTAGCTGTTTCACATGAGCATGTATTCCCAGTTTGACTGGGAGGTCTTGTAATGTCAACTTGTACTTTGGTGTTCCTTTTTTT
AACGATGAATCTTGCTTGCATATGATCATTTGACGAGTACCAAAAAAAATATGATTAGTTAAAAAAAAAA
page-top