Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6846  (registered. 2012)
Contig Information
Length 2048 bp
Clones alternative view 98 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_h Spike at heading date 2
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 8
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 12
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 14
WH_XN Leaves, plant was grown at constant 23 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218201531|gb|EEC83958.1|| hypothetical protein OsI_30065 [Oryza sativa Indica Group]
Score 690
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6846
GACGCGGGAGTATGGGGCGCGACATACACGGGCGGCCGGCCCTACGACGGACGGCGGGTACACTAATACATAATTTAGTATGGACAATACTACCCCTTAT
ACGTTGGGGTTGTACCGAAGTACTTCTCCTTACTATTATATCGACTCTAGTTTTTCTTATGGCGGTGATCAACTCATACAACTCAGCTTCATACACTACT
ACTGATAATAACTAATTACAAAGCATCAGAAACTGATGGTCCATCGAAATGACATTGCTCACTGACCGGTGACTGCTTCTGTATATTAGCTAGTAATAGT
ATGACAAAAACACATCCATCTTATAACTATGACGATGATTGATCCAGGGTGATTGGTTCAGCTTCTTCTGGCCTCACCATTTGTATTGCAGGTAGATGAT
AATCTACTCTTCACATGTTGCTAGACATCCATGCCGGTAGGCACCATGGGGCCGGAAAACTGAAGCACAGGGATGGCGCCGGAGCCGGCTGCTGCGGCTC
GGCCACGAGGATGTAGACCAGGCCCATGACGCCGGTGTGCTCTCGGTCGCTGCTGTAGTTGGAGACGATGGTCAGCACCTCGCCGTCGCTGACCTTGATG
GATCCTGGCTTAGGGTAGCAACTCGACATGCCGACAATGTAGTTTGCCTCGTTCCCTGCCTCCTTCCCTGTGCCGTAAGTTGGAAGCGATTCACATAGAA
GGCGTCCATCCTGGCCATGCAGAGAAGCACCGACTCCTCCAGAGTGCTGGTGTGCAACACTGTACACGATATCTCCTCCACGCGGCAAGACCGCTCTGGT
AGTCTTAGTATGGATGCACTCATTGTTGGCTCGGTTTTCCGCGCTGCATTCCTCAACTTGATACTCAACCTTGCAAGAGTGTTCATGAGTCCCGTCGAGC
ATAGCGGTATCCGTAACGTCAAATATGTAGATCTTGACAGGCACCACCGCATCAGTCCAGTCGAGCCAAGTCACGGTGTACTGCAAGAACACCTTCCGCA
CCTCGGCGTTGAACCCTGCTTTGAGCCGACACTGGGTCTGATCATAGCAGCAAAGCAACCCACCAGTGTAGTTCTTCGAGACTGTGCGCCCATACTCATC
AATTGTGACATTGTAGAAGTCGCACTTGCACTCGGTGCAGCTAGGCTTGTCGGCCACGCCCCTCGTGTCGATGGCATGAATATTGAGCAGCCATTTCTCC
TCATAGCCTTCAGGGGCCTTCTCTTGGTTGCCGGTCTCAATTCCATAAGGATCAGGAACCCATGTGGCGGTGTGGCGAGTCTCGGAACCGAGCCCGAAGT
ACTGGGTTAGTGCTCTCTTGCACACTCCATCATTCCCTTTAAGCATTGCGGGAACCTTTTGCGCATCAGAGCTCTGGTTGTCCTTGAGAGCATAGTATGG
TACTGCAACCCAGTGATGCAGGTAAGTCTCATGGAGCGGGACAGGGACGCCATTCTCATCGACGACCTCAGCATTAAAGCTCTTGACTGCAAGGTGGCCT
CGGGGGAAGTCGACGTCATGGTAGTACTTGTTTGAGACTGATCCAGGCCCCAGTAAGATGGGCGGAGAACGGAACGTCTTTGATTTCAGCAGATGACCTC
CCACGTTGAGGGCTTCAGAGGGTAGGGGGGCGATAGCCGATAGGAGCGAAATGAGCAGCACAGCAGAGCCAGCCATTTTCATCTTGTCACCAGCAGATTT
ATTAATTCAAGACAAGCCTGCCATGACATGAACCATTAGTAGCCACTACTGAAGCAAGCTGACTATTCAGTAACTTGTACGACGAGTCGAGGAGTGTGAA
AGCTCCCAGGTCAGGTATATTCCATTGAAGAGCAAGGAAGGTAGCAACTGGCTGAAAGTTGTACTAGGCATGTCAAGAAAGGCAGCATCCACATGAATAC
TTGAGTAACTTGACAAGACAAAATCCAACCAATAAACAAGGAGCGTACGCCAGCCTGCTTCGTGGTAATCTCCCCTGTGTCAATTCGATAATAAAATACA
GAAGACAGTAGCTTTCACAGGTGACCAGGAGGGAGGGACGGAAGAGGA
page-top