Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig15021  (registered. 2003)
Contig Information
Length 983 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit hypothetical protein OsI_34164 [Oryza sativa Indica Group] >gi|125575260|gb|EAZ16544.1| hypothetical protein OsJ_030753 [Oryza sativa (japonica cultivar-group)]
Score 721
Evalue 3.5009e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig15021
TTTTTTTTTTGAGTATGTGACGGTGTGAAGTTCACAAATAGCATTGCATATAAAAACAGCTTCAACCATCCAGGTTCCATGTGTACAATGACTACAGAGT
TTTTGCAACTCTTGTCATTAGATGTATTTCACTCAAAAGGGGGGTAAAAAGACTAAGAAAACAAGCACTTTTAGCAGTACATCCTTGGAAATAACCAAAG
CCCAGATTATTTTTGTCAACAAACATGATCTAAGTTACACCGCTCAACCTAGTTAATGTGGCAGCATGGCAATCGACCTGGAGTTTGCACGGTGTTCCGT
TGTTCTTCACAACAAGCCTCTAGGGTTTAGTTCCACCTTGGGTAATGGACGTCGCGAGAAGACTGGGATGGCTGCACGCTCTGGCTGTTGGCACCAATGA
AGCCTTGCAGAAGGCTCTGCGCCACTCTCACTTGGTCCGGCATACCTTGGATCTCCATGATGGATTCCAAAGAACCAGGATGGGCTTCAAGTAACTTCAT
TCTTGCACCAGAGATCTGGCGGATCTCTGCTAGATTGACACCACCAGCTCCAACAATAGATTCCAGAGAACTATTTGGAATCCTCAGTTCAACAGAGCTA
CTTGAATACCCTGTAACATCTGCCACTCTTTGATAATCCTCACGTCCATGCATCTGCCCGACAGCCTCGGTGTAATCATAAGCATTGGAATTTCCAGCTC
TGGTGACGCCTAATTGTTGCATATTACTATTCCCAGCTCTTGAGAGGCCTAATTGCTGAATGCCTCTACTAGAATAGCTATCAGTAGGCATATGGTCATG
ATAAGAACGATGCGACATGTAATCAGCACCAGGACTAACAGGCAAGGGCATTTCTCTAGTAGGCAAGCGAGCAGATGCTGCATATCTATCATAAGAAAGC
AGATGGGTGGAGCGTCGCCTAGCAAAATGGACTTCCACTTAGGATACTCTCTTCTTTTANAGAAGTAATCTACTGAATCATGG
page-top