Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6845  (registered. 2012)
Contig Information
Length 971 bp
Clones alternative view 71 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 20
Wh_V483 Shoot grown under cold condition for 3days 31
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XE Seedling, infected with leaf rust 15
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig6845
TTTTTTTTTTGATGATTCAACCTGTTGATGGGATATGTTTATTCAAGAAAGTTTTTTTTTTGACAAAGTATTATGTATTACGTTGATGGTACGTACATGT
AGCACACCAAGGAACGAAAAATACAAACATGAACTGAAACGGAATACAGATACACACTCTCTTTTTTTTGAGAAATACTGAAATACAGACACTCATTTAG
GGACGTGGACATGAGCGAAACGCCGGTGTTTTTCTTCCGGGCGATGCAAGCTATAGCCTATAGAAGTCTAAAACCCACAAGTTCAGCTTCAGCTTGTACG
TAACTCAGCACATGAAGTAGAGATGATCATGGGTGAGAAGGCACCCCAGGAATCACCACCAGCGGGCCGTTAATGGTACTGGTTCCGGTTCCCACAACCG
GCAGGTCTGGCAACCCCGAACCCGAAGAAGCCTTGGACTCGGCGACGCCGGCACCGCGTGTCGCTCCCAGTGCGCCGTCCTTCTGGCTCAGCTCCCTCCC
TTCGCAGGACGCGAGCACCACCAGCAGCAGGAGCGCGACGGCGAGGCACTTCGCCATATTGCTAACTGGGAGGTTCTAACTCGGAGTAGAGTACTACGGC
TGAGGACAGGAGACAGTCTGGATTGCGTGGCTGCCTCGTGCCTCATTTCACCGACCGACCGATTAATATTTGCCCGATTAATCTGCGACCGATACATGCA
TGGTAATAATCCGTTTGTCCTCATGCATGGATGGATGTGGCTACCTATTTACCATAATTAATCCTTGCCTGCATATGGCTGGCTGGATTATTTATTTTCT
ACCGTAATTGTGCCGTGTTTGTTTTAGTAATCGTCTGACAGCTGCTGCATGCCTCCGGCCGGGTTTAACATAGAGGAGGATGATATGTGTTGTGGTGAGA
TCGAGTCGAGTCGCCTGCTGTTGTAATAAGTGATTTTGACACTCTATATGACTGAAGTGATCATCACCAAC
page-top