Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14964  (registered. 2003)
Contig Information
Length 692 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Homology (BLAST) Top Hit alpha-gliadin storage protein
Score 416
Evalue 4.34416e-39
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14964
CACAATTTTGCACAACAACTGATTCCATGCAGGGATGTTGTCTTGCAACAACACAACATAGCGCATGCAAGCTCACAAGTTTTGCAACAAAGTACTTACC
AGCTATTGCAACAATTGTGTTGTCAACAACTGTTGCAGATCCCTGAGCAGTCGAGGTGCCAAGCCATCCATAATGTTGTTCATGCTATTATTATGCATCA
ACAAGAACAACAACAACAGTTGCAACAACAACAACAACAGCAACTGCAACAACAACAACAACAACAACAACAACAACAACAACCGTCAAGCCAGGTCTCC
TTCCAACAGCCTCAGCAGCAATATCCATCAAGCCAGGTCTCCTTCCAGCCATCTCAGCTAAACCCACAAGCTCAGGGCTCCGTCCAACCTCAACAACTGC
CCCAGTTCGCGGAAATAAGGAACCTAGCGCTACAGACGCTACCTGCAATGTGCAATGTCTACATCCCTCCACATTGCTCGACCACCATTGCGCCATTTGG
CATCTTTGGTACCAACTGAGAAGAGAAGAACTCTAGTACTAGATATATGAAACACCGTTTTCTTAGTCCATGATTTGGTCGTTGTAGCAGTGAAAAAATA
AAGTGACATGCACTATCATGTAAGAACCCGAACTATACTAGTTCAAACTTGGGAATAAAAGACAAACACATGTCTTGTCTACAAAAAAAAAA
page-top