Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14961  (registered. 2003)
Contig Information
Length 964 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Homology (BLAST) Top Hit Os08g0193900 [Oryza sativa (japonica cultivar-group)] >gi|40253673|dbj|BAD05616.1| putative N7 protein [Oryza sativa Japonica Group] >gi|113623151|dbj|BAF23096.1| Os08g0193900 [Oryza sativa (japonica cultivar-group)] >gi|125602467|gb|EAZ41792.1| hypothetical protein OsJ_025275 [Oryza sativa (japonica cultivar-group)] >gi|215741545|dbj|BAG98040.1| unnamed protein product [Oryza sativa Japonica Group]
Score 653
Evalue 2.60281e-66
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14961
CTCCCTTTCCTACCTTCTCGAGGAGCCTCGCCGACTGCCGCCACCACCACCGCCCCAGGACGGGATGGATACAGAGGCGGAGTGGAGGGATTGGGCGGAG
CTGCCACGGGATGTGTTGCTGGCAGTGCTCAGCAGGCTGGACCACATCGAGATTCTCATGGGGCCCGACATGGTGTGCAGCCCATGGCGCAGGGCTGCTA
CGGACGAGCCCGAGCTGTGGCGCCGCATCGATATGCGCTTTCACTATGCCGATGGCTTCTACCTCAACTCCAGGAAATTGCTTCAGATGGTGAGAGCTGC
CATGAGGCGTGGTGCGGGTCGGTGCGAGGCCTTCTGGGGTGGGAGCTACGTCACAGAAAGGATTCTCTCCCTCGTCGGCAACGCGGCGCCATCATTGAAG
AGCCTTCGACTCATTGAGTGCCATGACATTGTGGACTTGGCCTTCAAGCTAGTGATCACAAAGTTCCGCATGCTTGAGGAGTTAGAGCTCTCGAATTGTA
TGCACCGCTTCCCAGAAACACTCGAAGTCGTAGGGGATGCTTGTCCTCTACTGAAGCGCTTTCGATTGAGCCAAAGGTCCTTCTACAGTGAATGCGTAGA
TGACAGCGCAGCCATGGCGATCGCTAAGATGCCGGAGTTGCGGTCATTGCAGCTCACTGCTAATTCGCTCACCAATAGTGGTTTGGAACTCATCCTTAAT
GGTTGCCCGCTCCTTGAGTCTCTCGATATCCGGTCTTGTTACCATGTTTGCATGGATGATGAAATGCAAGCAAAGTGTGCTAGGATCAAGACTCTGAGGC
ATCCTGAAGACTCCATGGATGATTATGACATGTCGTTTAATTATACAATTCCGAGACCATGCTGGTCTACTGAACCAATCGAATACTCTATGGGTTGTCA
AAGTCCTTACTAGTGTTCATGGTATGTACCGGTAGAACATCCACCCTACATTTCTTGAGATTCG
page-top