Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6839  (registered. 2012)
Contig Information
Length 1035 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_CSEC Callus 1
Wh_OKCS Seed DPA5 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_CA 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115442143|ref|NP_001045351.1|| Os01g0939700 [Oryza sativa (japonica cultivar-group)]
Score 397
Evalue 1.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6839
TTTTTTTTTTCGTAAACACAGAAAAAATTGCAGATACGGACGAGGGCAACCTACCACGTGACATAGCTCCTGCCACGCTTGGCGTCTATGCTTTACTCGC
CCGTGGCCCAGGCTGCCACAGTGCGCCACACACGCTTTAAACGAAACGCGGCGCGCTCGCCACAGTACTACAGCAGCCAGCAGCGCCAGTAATTCTACAG
AGTGAATTTCCAGCCAGGCACGAACGCGCACTTGAGAGACGACCGCAAGCCGTCCACATTATTTCCACACACTTCATCTCGTCTCAATCCAACACACGGT
GCATCGACACATACACACACGACAGATCGTAACAAGCTGGTATATGGAGGCGACGCCGCTGACTTGGCGGTTCAACTGATAGCATCTCTCGCTACAGGTG
GCTGGCCAGTCAGCCGCTCTTGAGGAACTGGGCGTGGTGCGCGATGTGGTCGTCGATGAAGGTGGCGATGAAGAAGAAGGAATGGTCGTACCCCGGCTGC
ATCCGCAGGGTCAGAGGAGCGCCCGCCGCCTTGCACGCCTCCTCCAAGTTGCCCGCCAGCAGCTGCTCCGCCAGGAACTTGTCATCCTCTCCCTGGTCAA
CCAGGATAGGAGTTGAAAGTGTGTTGCACTTCTTAACCAACAAGGTTGCATCGTATTCCTCCCATTCCGATTTAGTTGTGCCCAGATAGTTTGAGAATGC
TTTCTGACCCCAAGGGCAGTTTATTGGGTTAGCAATTGGAGCAAATGCAGACACCGACTTGTATTTGTCAGTGTTCTTCAAGTAGATAGTCAGTGCACCG
TGCCCTCCCATAGAGTGGCCAAAAATTGATGCACATGACGTGTTAAGCTGTTCAAAGTTGTCAGTTAAAACTTTTGGCAGCTCCTTCACAACATAATCAT
ACATGCGCCAGTTTTTCCACTTCTCATTTGTGGCATTCAAATAAAATCCAGCACCAACACCAAAATCCCAACTATCTGCCTCCCCTTCTACATTTAGTCC
ACGCGGGGAGGTGTCGGGGGCGACGAGGGCGACGC
page-top