Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14909  (registered. 2003)
Contig Information
Length 1409 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit Os05g0295100 [Oryza sativa (japonica cultivar-group)] >gi|113578660|dbj|BAF17023.1| Os05g0295100 [Oryza sativa (japonica cultivar-group)]
Score 1670
Evalue 0
Total Hit Count 169
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14909
GGCGAGCTTAGGAATGATGCTAACACAGATGTTATGGAGGACGACTCATACCGCGATCAGGGTTTTACACGTCCAAAGGTTCTTTTCTTGTTACCTCTCA
AAAGCATTGCACGACGCATTGTGAAGAGATTAATCCAATTATCTCCGCTGACACAAAAGGATAATTCTATGGGACAATTCAAGAAAGAGTTTGGCGAATC
AGATGATGAACTGGAGGAGCCAAATAGTTCAAAACCAACAGACTTTAACCTTCTGTTTGCTGGGGATGTTGAAGATCACTTTCTTTTTGGAATAAAATTT
ACAAAGAAATCTGTTAAGTTATACAGCAATTTCTACGCTTCTGATATCATAGTTGCATCTCCTTTAGCGCTTAAACTTAAAATTGATGGAGGTGAAGTTA
CCAAGAAAAAGGGACGTCCCAAGGAAAACGATTCTGATTTCCTGTCATCAATTGAAATAGTGGTTGTTGATTACGCAGATGTGATATCTATGCAGAATTG
GTCGCATCTGCATGCTGTTCTTGAACAACTAAATCATTTGCCATCAAAAGAGCATGTAACCAATGTGATGCGGATCAGGCCATGGTACCTGGATGAGCAA
GCACGGTACTATCGGCAGACAATAATATTAAGTTCGTATCTTACGCCAGAGATGAATGCTTTGTTCAACGGATCATGTCTAAATTACGAGGGGAAGGTTA
AGCTGGCGACTGAGTTTACAGGTGTTCTTCCCAAAATACAGCTTGAAATACGGCAGGTGTATGAACGATTTGATGCATCTTCTATTGGTGAACTTGATGA
TGCCCGCTTTGAATATTTCTGCACAAAGGTGTACCCAAAGATTCAGGAGTCAGATGAGGGCGGAGTGTTGCTATTTGCCAGTTCCTATTTTGAATACATT
AGGCTGAGCAGTTTTTTGAAATCTCAGGATGCTTCTTTCTGTAGAATTGGGGAGGCGACGTCACAACAGGATATATCTCGTGCAAGACTCTGGTTCTTTG
AGGGCCAGAAGAAGATCTTGCTTTATAGTGAGAGATCTCACTTCTTCCACAGATACAAGATCAGGGGAGGACATCATTTGGTTGTCTACTCATTGCCAGG
GAGAAAAGATTTCTATCCAGAGCTTGTAAATATGCTCGGTGAATCAGGAAACCCCAGGTGCAATGTGCTTTTTTCTCGTCTGGACCTCCTTAAGCTGGAG
CGGATCGTTGGAACATCGTCTGCACGGAGGCTGATTTCTTCCGACAAGGATATGTTTGTCTTCTGCTGACCGTGCGCGTTGAGCGTATGCCAGACTAGAA
TTTTGGAACATGAACTGAAATCCGCTGTTGACTAGTACAGTACAACTGAAAGTTTTTGTACTATCTGAAGTTGCAGTAGCGGATGTAGACGATTAATGCC
TCCAGATTG
page-top