Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6831  (registered. 2012)
Contig Information
Length 1593 bp
Clones alternative view 395 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Wh_r Root 11
Wh_yd Spikelet at late flowering 1
Wh_SH - 4
Wh_DPA20 Seed DPA20 3
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_RDr Root of dessiccated seed 4
Wh_SHDr Shoot grown with dessication 27
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 8
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 19
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 21
WH_XR Roots, 18 day old plants were grown hydroponically 36
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 52
WH_XT Roots, 18 day old plants were grown hydroponically 57
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 38
WH_XA Root 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XE Seedling, infected with leaf rust 24
WH_XF Seedling, infected with leaf rust 18
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 30
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222632510|gb|EEE64642.1|| hypothetical protein OsJ_19496 [Oryza sativa Japonica Group]
Score 565
Evalue 7.00E-159
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6831
TTTTTTTTTTTTTTTTTTTTAGGAGTAGTTAATTAGGTAAATCATTCATTCTTACATATTCATCACTCCATCCATAGTGGAGATAGATGAAGCAATTACA
GGGACACATGCACACACATACACACAAGGACACCAAGGGCAGAGCATAGGCGGAGAGCGAGCGAAGTAAACCACACGCACATGCACACGCACCCTTGCTC
GACTCCATCAGATCAGACGCTCGTTATTCACGTATACTCTCACACCATCACACGTACGTACGACGGTACGAGTGCATGCAGCTTAACAGTTGCAGGGGTT
GCACTTGCAGTTGTCGCCGCAGCTGCAGCCCTCGCCGGACTGGCCGGCGGCCACCTCGAACTGACCTGCCTTGTTCTCAGGCGCCACGCCGAGGACGACC
ACGGCGGCGACCTGGGCGGCGGCACTGCCCTGCTCCGTCAGATCAGGGTACACCTTCCCGCACTTGCAGTCTGAGCCGCAGCTGCAACCGGATCCACAGT
TGCAAGACATCCTCCAAATCTGATGAACCCAAAAAGATTTCAAGGAGAAGAAGATGAGCTTTGGTGTCGAGGATGATGATGAGCACGAATTCGGCACGAG
GTTTGGAAGAAAGAATCAGCTATATATGACCCTCAGAATAAGGGGAGACATGTCACCAAACAAGGAGTAAAGGTGAACACACACTACGGAACGATAAGTC
GACAAAAAATTATTTTGACCATGCAACTGCGTCGATCTCTGCTTGGGCGCTCCGGTATAGCTCCAGCCTCTTGGCGAGGTTTGTCCTCCGCTCCATGACC
GCGGGGTCCTCGTCAAGGAGCTTCGAAAGTTGCCTAATCTCTCTTGCTCCCAGCTCAGTAAAGAAGTGGTCGAGCAATGAGCGCTTTGCCTCACGGACTT
GGCAGTACACAATAGATTTTGGGATGGAGTTCCTCAATGTTGAAGATACCATGTTAACATATGCCAGAACAGTTGTCCCAATTCGTCTTAGATAAGAATC
ATTATATCTATCAAAAATAGAGTGGCTTGGATTTCCACCCTTCTCAACATCCTGAGGAAGCTTCCTGAAAAAATCTACAGTTAAGTAGCTTGTTTCCATA
TCAACTAGCTTTAATGTGTTCTTCTTGCTTTCGTCCCTCATTCTTTCCAACGACTCAAAAGCTGCATTGCCAACTTCCACACGAAGAGTGGGGAACTGCT
TGAGCTCATGAGTTTCATTTATAGCCTTGTGGACTAGTTCCTTTAGGATTCCATGGACCGTGTCAACAGCTGCCTCGGCAGGACCTCTGATACTAACAAG
ACAAGATTCTATGAGGCGCCGATATCCTTGCTCTGGAGCTATCAAGTGAGGCTGGTATCCATCAGCTTCCGTTATGAGCTTCCTCACATTTTCCATTGAC
AGTTGCTTATCAAACTGCAACCGTTTAATTGCCACAGGAAACTGATTGTCAAAGACATGGTAAATTTTCTCACCACCAGGGCGCACTCCATCCAGATGCT
CTTTGTAGATGCCATCAAACATGCGGCATATTTCCATAATCGTGTACAGCTTTCCTCCAGCATCATTAGCAATGGGCTTTCCAAGACGAGTAA
page-top