Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14845  (registered. 2003)
Contig Information
Length 771 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit acetyl CoA synthetase [Deschampsia antarctica]
Score 854
Evalue 8.67464e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14845
TTTTTTTTTTCTTCGGCCAATCAATACATTCACGGAACTCTACGGATATGTGATACACAGGTTTACAAAAGTGAAACACAAGGAGAGAACATTACATTAC
ACCACGCTGCAGCTCACTAGCCTCAGGAGAAAATCGCACTGATTAAAAGGACTAGCGAGCACTAAAAGCAACCTTCTACCAACCACATAACCGCATAGGG
GAAAAAACAGTCGCATAACTGCTTTACATCCTAGCAATCTTTGAGCGCGATCAGCTGGTCGACGACGCCGGGGTCAGCGAGAGTGCTTATGTCGCCGAGC
TCGTCCAGCTGCTTCGCGGCGATTTTGCGCAGGATCCTGCGCATGATCTTGCCGCTGCGGGTCTTGGGGAGCCCCGGCGCCCAGTGGATCCTGTCTGGAG
CTGCAAACGCCCCGATCTGAGTGCGGACTTTTGCTATGAGGCTCTTTCGTAGTTCTTCACTGTAAGGAACGCCATCCACCAAAGTTACAAAAGCATATAT
TCCCTGACCTTTGACCTCATGCTCAACACCAACAACAGCGGCCTCTGCACACTGTGGATGCGAAACCAAAGCAGACTCAACCTCTGCTGTGCCAATTCGA
TGCCCACTAACGTTGATAACATCATCTACTCTTCCAGTAAGCCAGTGGTAACCATCTTTGTCCCTGCTGCAACCATCACCAGTAAAATAGTAGCCAGCAA
ATGGCTTGAAGTATGTGGTCTCATATCTGTCATGATCTCCATAGAGGGTCCGGAAAGCCCCAGGCCNTGAT
page-top