Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14798  (registered. 2003)
Contig Information
Length 680 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 4
Homology (BLAST) Top Hit GM19606 [Drosophila sechellia] >gi|194122530|gb|EDW44573.1| GM19606 [Drosophila sechellia]
Score 377
Evalue 1.38831e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14798
CTTCATTTGCTCTTCTGTTTCTCGCCCCGGCTGGAGGGGCTTGTTTAGCGTGTGAGCTTTTTCTCCTGACGCAATCCGCTCTGAATCTGATACGGTTAGG
TGTATTTTTCAGAGATGTAAACCTGAAACTAGAGAACATCTGGATGCCTGGTTCTGCCCTTTCCCACTGAAATGGATGCTCCTCTAGCTTGCTGTAAATC
ACGAAGCCGGCGATCCGGCGGCTGGCGCGGCGGGGCGGCGTGAAGCGCATCTCGGGGCTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTCG
AGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGACGTCGTCTACGCGCTCAAGCGACAGGGCCGCAC
CCTCTACGGCTTCGGCGGCTGATCTGCTGCTGCTGCTCCGTCCAGTCTCTGCCAGCTGCTGTTCCATCGGTCTGTGTGGTAGTGGACGCCATGAATATGA
ATGCAATGAAATCAGAGTCGGCATTAGTTATCTTGGACGCATCTCTCGATATGTTTCTGTAAGCTTGTTAAATTCTTCCCAGCAAGAAAGATTAGGAGAT
AATCTACTAGCTGAGGTAAATATCGGAAATTCATGAATCAATCTCTAAGCAAACATTACAGTAGACTGCTATGGGTGTGT
page-top