Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14699  (registered. 2003)
Contig Information
Length 1487 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit hypothetical protein OsI_32911 [Oryza sativa Indica Group]
Score 1465
Evalue 3.40577e-160
Total Hit Count 165
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14699
GTAGTATTCGATTATTCAATTGTCTTTGATCCCGAGCACGAAACAGCAGTTGCAACCAGACATCGCGACATATACACATCTGATAACCATATGCTGTTGG
TACGCGCAGTTAGTTTCCTTCCTAATGTTCCTAAGCGTGGACCCAGTTTGGTACTAGCAAGAATATGAACAACGTCAGCACTTGACACCGTGGTTTCTTC
ATTAGCCTTGGTCGCTGCTCTGCATCCTTAATGAAATAACCTTCACATGTACGGGAGCTGCTGCTGGCTCTTCCGCACCTGTAGCTCAGTAGAAAGCTGA
GAGCATTTCCTTTTTGTTTCCTCTAGTTCATGCTCCAACTCCAAAATCGTCTGCTTCAATTGTGTATCTCGTTGTTTAAGCTCCTCGCGCCTTGTGAACA
GAGAAATGTTTTCATCACTCAGCTTCTCAAGGAAATTAGGATCAAGTTCACCATCAGAGGCAATATTGACTAGATCCTCTTCCAAGCCTGCTGAATTCGT
ACCGTTTTCTTGTGCTTGGCCAGAAAATTGCAAACCAGAACCTGCACCATTAGTTCTCAGTCCAAAGACTGCTGCATCATCATATGTTTCCGGTAGCAAA
TTTGATGAATGCGCTCCAATCCTCTGAGCAGTCGATGATGAATGCACTCCAATCCTCTGAGCAGTCGATGATTTCTGCTGAAACTCATGTCCAGGACCAC
CTGAACCTTTGGCAGCCTTATACTGTGTTTTTAATTGTGGATTCATTGGCTGGTAACCTATCAAATGACAGTTGTTTTTCCAGTACTCAATGATAATTTG
TCTAAGTTTTGTTTCCAAACGAATGAATAGTGGAGTCCTCTCGAAATCCTGTTTGTCATGTGCCGGTTCAATAAAATTTGCCTCAAGTACACCTACAACA
CTCCTCCCTCTGCTCGATCCTTCCTGAAGAACCTTCCAGAAGGGCATTATTAGTCGATTTTTATGGTAGACATTCATCCCAAAAATGCCCAAAACTGGCG
CCTCCTTGGCAAATCCGACATCTACCTTCACTGAGACCACTTGAGAATCAAGCGCGACTTGAGGCTTGTAAGTAAACATTTTCTTGAACTTCAGATCATG
AGCAATGTTTATATGTTCAACCACTTTTCCTCTTAATATAATTTGGAAGTTTGCATACTTCTTAAGATAAAGGATGGAAGTATACGCTCGCAAAGAGAAT
CTGAGTCTGTGGGATATATGTTGCTCAATAATTTCTTTTTGGATCTTTGTCGTCCCCGCAGTAGCTTTAGCTTGATCTCTAAGTAATATGTCCTCATCAT
CATCATCGAAGTCAAGTTCTAAAAGGCCATCATCATTCATCCATAGATCATATATCACCACCTTAGTTCCATGGCTCTCAATATCCTTGAACTGCTGTAG
CAGTTCTTCCATTGAAGAAAAGGGGGACCAATCAAGTATTATCTTCAAGCTACTGTCCCAATCACCTTGTGAACCATACACCAAAGG
page-top