Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14611  (registered. 2003)
Contig Information
Length 853 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Homology (BLAST) Top Hit hypothetical protein OsJ_024118 [Oryza sativa (japonica cultivar-group)]
Score 152
Evalue 2.65038e-08
Total Hit Count 400
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14611
GACGATGAATCTTCGATTTTTCGCCTCTCTAGCGATGGGAAGGCTGTCCTCACGCCGGATCTGCGGCCAGGTCGTAGGACCGGCAAGGCACCAGCTCTCC
AAGAACATCCCTGCTGGTGTGCGCGGATTCGGCTCCTTTGACAGGTTGCCCATTGGCCAAGTCAAAGACTGGTCACTTGGCACTGTTATGTCCCTGGGTT
CCTTGCCAGTCTTTGCTGGAGGCATATGGTATCTCAAAACTAATCCAGAGGAGCAGGGTGCTCAGAAGCCCACCGTTGAGGACCCGGAGGAGAAAGCCAT
GAAGAAGAGATTCGAGGAGTGGATGGTTGTGCACAAGCGCAGATACAAGAACGAGGAGGAGAAGGCACGGCGCTACGAGCTGTTCAAGGGGTGTGTCAAG
CGGGTGAACGAGCTCAACGCCGCGTCACGGCCGGGTGAAGCCCGGTACAAACCATACCGATATGCTGACTTTACCAAGGAAGAGAGGAGCAAAATACACG
GAATCGTGGTCGAACCATCTATGTTCGACGAGTGGAACGAGGAGAAGAGGCGCAAAACACAAGGGGGCCATGACGGCGGCGCCGACGGGGACGACTGGGA
AGAAGAGATGCGCCTGATACAAAGGTGTCTTCGCACTGCGGCCCTTAATGGCAAGGCACAATGCAAAGCACAGCAGTCGTCCTAAGTGGTGAATTAGTAT
CTATGTTAGCTTCCATCGGTGTGTTATATCGATATATATAAATGCCCCTGTGATTGGTGAGTTTATGCATGCCAATGTCTGTTGCTACTTATGCCTGGAG
CCTTGCAGTGTTGAACTTTAATTAGAACTTCCCCTGTACCGCTGTACGTACTC
page-top