Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14571  (registered. 2003)
Contig Information
Length 723 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit mRNA transport factor [Triticum aestivum]
Score 608
Evalue 2.56819e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14571
TTTTTTTTTTAACGATGGAAGAAATAATGATACAAATTACCCATCAGGCATGTGGCATAATTGTGGCAAGAACATTCCAATCCAACACATCACGGATCCA
ACATCAACGGCTACAATTGTCTCAAACTGGCAAGCCAAACTTCAACAGCAAACATGGCTCCATCCACCAAAGGAAGGACCTTGAGATGCCATACAACTAC
TACCGGAAATTGGTACAGAGAGACAAGGGCCGCCATCAAATTACGATAAGACAAGCAAACAACTGAATCCCCATGATTCTCGCAATTCCGTCGCTCCTAA
GGGTATCTTCTCCTTGGTGGGCTCCTTGAGCGATTAGGCCTCGGTGATCTCTTCCGAGTATTTCTCTGTTTGACAGGGCCACTGCTAAATGCCCAGTCAA
CACTTATTATCTGCGAAAGAAGCTCAGTTCCGTCTGATTCTCTTATTGCACGCTTGGCTTGCTCAAAGTTCTCATACTCAATTAGAGCATATCCCTTCAC
AAATCCAGTCCGGCGATCCAAATTCAAATGCAAGTTCTTGACCTGCCCATAATCCCCGAAAATATTATGGAGGTCCTCCTCCTGAGCTTCTTCATGAACT
CCAGTAACCAGTACAATCCACCCTTCAATGGAGCGCACGGGTCCAGGGCCGCCATCGGAGGCGAGGGCGTCGAAGCCTGAGCGGCCTGCGCCAGCTAACC
GCGAGTCGCGGTGCGCGGACGAG
page-top