Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig68  (registered. 2012)
Contig Information
Length 766 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|188038088|gb|ACD46678.1|| hypothetical protein [Aegilops tauschii]
Score 335
Evalue 2.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig68
AGCATTACATCGACCATGACACAGCAGATGAACCAGCATGAATTTATCCAAACGACAAACAAGTCTTGAGATTCGTCACACACGCTAGGTAATAACAACA
TAACAATTCACCAAGGTTCCGATTGACTGACTATAACGATAGTACGAGCAAAGCTACTGCAGAAACGAGTACGACAACGGCCTAAAGAGCGAACAAGGCT
TCTGCTAAAACCATACGAATACCATGCCTCCCGAAAGGGCAGATTCAGAGGGCGCCACCAAGACGAACCAATCACCTGAACTTCGGCTTCTTCGAGGGCG
GCCCTCCCTTGGAGCTACTGGGAGGCGGGCGAGACTTGTTGCCGCTGCTGCTGCCACCACGCTGTGGCAGCGGAGCATGCTTGCTGCTGCTAGGACCACG
CTGCGGTGGTGCACCGGACTTGCTGAAGGTCTTGACCTTGCGGCGCCTCCTTTCTTCCTCGCTGTCTGACTCTGCGCCATGATCCCGGTCCGCGTTGGTC
GCCTCCCGCTCCAGCTCGTCCCAGGTCTTGCCCTTCTCTTCCTCAGAGTCTTCATCAGAATCCTCTTCCTCATCCTCATCTGATTCCACCAACGACGCGC
TGTCAGAGTCTTCCTCTTCTGATTCAGACTCAGGCTCAGCATCAGAAGGCTCATACCCCTGGTCTGATTCCTCTGTTTCCTCTGCCTCAGAATCACTTGC
CTCCATGTTCAGGAACTCCCAGCCACCATCGTCAACAAACTTCTGGGGATCATCAATGATAGTCTT
page-top