Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14515  (registered. 2003)
Contig Information
Length 856 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os08g0517700 [Oryza sativa (japonica cultivar-group)] >gi|42408741|dbj|BAD09977.1| oxysterol-binding protein-like [Oryza sativa Japonica Group] >gi|113624214|dbj|BAF24159.1| Os08g0517700 [Oryza sativa (japonica cultivar-group)] >gi|215678686|dbj|BAG92341.1| unnamed protein product [Oryza sativa Japonica Group]
Score 960
Evalue 5.41028e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14515
ATGGTCAGCTTGATTATATGATTTAACATTGTTATTACATGATAATGTAGTGTCATGAAGAAGGAGAAGGTACAACGATAGGAGCTGGACGCACTGATTT
CTCTAATGGCCAGCACTCCCAGTTCCCATCCTTGTCCTGGGACAATGAGAAGTGCTTGGGCATCCACACCTCTCCCTTCTCATTCCTCTCCTTCTCAAGG
CTCCTAGCTGTGCCCTCGACTTTCCGCTTCGCCTCGCTAGCCTTCTCCCAATCCTTTGCCAGGATAGCCTCGCTGACTTCGCTCCAGACGACCGCCGACT
CGGTAGATGACAAGCCCTCTTCATCTTTAACCTCCGGTGTGACGAGGTTAGCGATGGAGAGGTTCGCGTCGTAGAGAACCAAGACCTCCCCACTCTCAAC
ATCCTTGAGTGAAACAGTCCTATCCCAGTAGCCATCGATCTCGAAGACGGTGTCCTGCGGGCTCGATGAATGGAACACCTTGCCCTTAACGCACCTCCCG
TCACCTCCCATTCCCATGAAGGAGTTGCTTCTGTGGTAGCTCAATTCTGCCTCGAGCCCGGAGTCCTTGCAGACGATCCTGACGGTGCCGGACCACTCGA
CGGAGGGCCCAGGAAGCAGCCTGATGAGCAGATTTGGACAGTCCATCTCGTATGTCTCGTTGAACTTTGGAAGCCTGACTTGCCTCTTGCCGTGCACCGT
TGCCTCTATGCTAGCACCATTAAATTTCGGCACTGGGTGTTGGCTCCAGACAAGCTNGACGTTCCCGCCGTCATCGGTAGCGTGAAGCGCAGAGACCGGG
GGTTTATGACACACCTGCTCAAGAAGGACATGGAGTGACCCTCTGGAGACATGGTG
page-top