Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14502  (registered. 2003)
Contig Information
Length 708 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_OKCS Seed DPA5 1
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsI_16154 [Oryza sativa Indica Group]
Score 700
Evalue 5.2629e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14502
TTTTTAAGCACCGATAGCCGCTCTGGCCTCACGGCATAACAGCTACCCAGCCCCACGAATCGCGCCACCTCCAAATCCAGAGTGAACACATCTAGTACGA
TCCATTAACCAATGGTAGCACTACTACTACCGTAGCAGCCATAGTCCAGCCTAGCTAGAAGGAGAACGTGAAGCGCATGTCGTGTTTGTACACCTGGCCG
GGCCTCACCGTCACCGACGGGAACTCGGGGTGGTTCACGGCGTCCGGGTACGCCTGCGTCTCGAGGCAGAACCCGCCGTACTGCTCGTACAGCTTGCCGC
CCTTCCCCTGGGTGTGGTTCAGAAAGTTGCCGGTGTAGAGCTGCATGGCCGGCTGGTTGGCCCACAGCTCCAGCGCGCGCCCGGACTTGCCGTCCCGCGC
CACCGCCACCTTCCGCATGCCCTCCCCGTCGATGACGTAGTTGATGTCGTACCCGTAGACTTTGCCGCCCATGACCTGCCTGATGCGCGCGCCGATTGGC
ATCGGCGTGCGGAAGTCGTANCTGGTGCCAGCCACGGGGTCGACGCGGCCGGACGACNGGAGCATCTCCCCGTCCAGCGGGGTGTAGCGGGACGCGGANA
GCTGGAGCGTGTGGCCCANGATGTCNCCNCTGCCCTCCCCNCCCANGTTCANGTACACNTGCTGCAANGAANTTCANCGGCNTCNCCTTGTTNNNCNCCG
NNNCNTTC
page-top