Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14454  (registered. 2003)
Contig Information
Length 908 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_RDr Root of dessiccated seed 2
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 272
Evalue 3.57095e-22
Total Hit Count 111
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14454
AAGAGTTAGTGAGCTACTATTTCAATGTCTTCATGTTGAGGAAGAGGGCTGAGCAGAATAGGTTTGATCCAATGAATGTTGACAGTGATAATGATGAATG
GGAGGGAAGAGATGATGATGAATTTGCTGTGACAGAAAGGGCTGGTGAGGATTTGCTGCTCGAGTCTCTTACTGATCAAGATGATGGTGCATGCAATCAA
GTTCCCCTCCAAGGAAATATGCATGAAGAGTCTGGTGAGGAGGATGAGTTTGACTGTTCTAGTGGTGACAGGCAAGAAAATTGCTGTGTGGAGGGGAATG
TCATGGTGTCCCTTGTGGACAATAACCAGGAGGCAACCATTTTTGACACAGATGCTCAAGACGACTCGTGCACATCATTTGAGGCTCCGCATGTTTGTAC
CACGGATGGCACACCCACTGATATTGCTGGAGACCACTACCGGGATGTTGGCTTTGGTAGCGTTGCAGATCATGGATACTTTGGTGGCCACTGCGACCCG
AAAACATGGGATATTGGTTTCAGTAGCGTGTGGGAGAAAGACGAATTTCTTTCGACAAACAATGTGATAGAAGAGGTGTTTGGAAAGGGTTCTTGTGAAA
ATGGAAATGACTCTTCTACTGCCCAGGGCATCATGTAAAGATGATCCGGGTTTCTGATGGAGAGCGAAGGCCGAACCTGCTTTTGAAATTTGTACAGTGG
TAGCTCTTCCTTTTTTTGATGATGATTCACTTGCCTGTAGAAATCCCGCCTCTGTCTGTCCCGAGAACATCTGTTTGAGAAATGTAATTTCATTCTCATG
ATGAATGTCTGTCTATTTGTAGTTATCCATCATCAGTCGATGATCTCCTGTAGCCTGTTGTAGCCTCTATGTACTGTTGTCATGACAAGTTTCAAGGCCT
GAGCATTT
page-top