Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14428  (registered. 2003)
Contig Information
Length 465 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit Os04g0635500 [Oryza sativa (japonica cultivar-group)] >gi|38344804|emb|CAE03005.2| OSJNBa0043L09.24 [Oryza sativa (japonica cultivar-group)] >gi|90265181|emb|CAH67652.1| H0410G08.7 [Oryza sativa (indica cultivar-group)] >gi|113565579|dbj|BAF15922.1| Os04g0635500 [Oryza sativa (japonica cultivar-group)] >gi|218195664|gb|EEC78091.1| hypothetical protein OsI_17575 [Oryza sativa Indica Group]
Score 355
Evalue 2.01858e-32
Total Hit Count 118
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14428
TCATAGCCAAAATTTTCATCATCATCATCGTCCTGGTATCTTTACAAACCGATCAGGGGTCAACCAGAGCCAAGTCTCAGCCCATGGATGCTTAGTAATA
CTAAGTTGCTTGCTGCAACAAACACAACACTCCTAGCTACTACCACTCCTAATTTAGGCCCCAGCAGCTAAGGTACATGACAGTCCTCAGCCCCTCCTCG
GCCTTCTCCGCTGGGCGCCTCTCGGCCACGGCGGACACTGAGGCAGGCAGCTGCTTGTTACCCTGCGAGACGCCGCTGCGGACGTTGGCCTTGGCTGCCC
GGTGGATGGACCTGAGCGTGTAGTTCCAGCGGCAGAGCCCGGCCTGGTCCTTGAGCGCCTCCACAGTGCCCACGCTCATCGCCACCATCCACGATGCCTT
GGCTGGAGCTGCCATGGTCTATGCTTCTTGCTGCGTTGCTTACAGCTACGGTACCGAAGGAACTG
page-top