Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14425  (registered. 2003)
Contig Information
Length 657 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit hypothetical protein OsI_26354 [Oryza sativa Indica Group]
Score 548
Evalue 1.88848e-54
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14425
TTTTTTTTTTGTTCGCTGCATTGTGAATTAAGATCCAAAAAAACAAGAAACGAGAAACTGGACAGTGGTTTTCTCGGTTCAAGAGACAAGGGCTTCTGAA
TTCAGACAAAGACAAAGAGAGGACCCTCCAGGGTCTTAACAGTTTGCTTTGCAGTTCACTCATCAGCAGCAGCAGCTTAGATAGATACTTAGATACTAGT
AGGTATAGGTTCGAAGTGTCCGTAGATCAGAGAAAGCCGGTCGGTCAGAGAACAATGGCAGAGCAGTAGCATCTGCTGCCGATTGACTTCATCCCTGTAT
TCACCCAACCACAGCCTTCCTTGTAGCGCTCCACCACATCCAAGATTGTATCTGCTTCACCTTTGACCCCACCCAGAGTGAATATCGAACCACCGAGCAC
AGCTGAAGAGTGGTACCCTCTGGTGTAGTTCATTGGTTCCACCATCACCCATGACGGCATTCTTGGCTCGTACAACTCAACGGTGGATGCCATTGCTCCA
GCATCAGCATCATAACCACCCATTACATATATCTTCTCATCAAGCACTGCCACTGTATGACAACCTCTTACTGTACTCATTGCTGGGAGCATTTTCCAGT
TAGGCTCCCTAGGATCAAGCCTCTCAGCAGAGCTCAGATACTGAACGCCATTGAAAC
page-top