Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14373  (registered. 2003)
Contig Information
Length 362 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Homology (BLAST) Top Hit polcalcin Jun o 2 [Zea mays]
Score 99
Evalue 0.00986522
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14373
GCGTGGACAAGAACGGCGACGGCCTCATCTCCTTCGACGAGTTCAAGGTCATGATGGCCTCCGGCTTGGCCGCCAAGATGGCCTGACCCGTCCATCCTCT
TGTTGATTCAGCGATTTCGTCCACGCCTCCCTCCCTCCTTCCTCTCGCGTGCCGTGCGGTGCGGTGCGGTGCGGATTAAGTGCGAATTAAGTGTACATAA
TTCAAGGATTAAAGGGCGGCCATTAGAGTAGATTATTTCTTTCGTTTCTTGGTGGTGCGAGTAATAACTAGAAATCTCTCGCGAATAACTGTGTCGCGAA
TATCGATCTGAGATCAAAGAGATTGACGAGGCTTGAAGGGGATATAAAAAGCAAAAAAAAAA
page-top