Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6780  (registered. 2012)
Contig Information
Length 2220 bp
Clones alternative view 64 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_SH - 1
Wh_EM Dormant seed with water absorption 4
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 5
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1737492|gb|AAB38974.1|| poly(A)-binding protein [Triticum aestivum]
Score 1289
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6780
TTTTTTTTTTGAAACAACCACGAACGAGAAAGCAAGATAAATTCAGTGACAAGCAGACGATAACTTAAACAAAACAACCAATCCATGCAAATAAAATAGC
CAATCCATGGGAAGCCTAAAAGACTAGTTCAACTACTGGCAAAAGCTAAGTCTCCAATAAACCAAGTCATTTTCAGTCTAGATAAGTTTGATATGGTGCA
AAAATTGTCGCCGTGGAGCTTAGGAAGAGATGAGGCCGTCATTCAGCGAGAGCGAAGCCAGCTGCTGCTCAGGGGACTGGTTGGTGTGCTGCTGAGCGCT
GCGGAGAACCTCCATGGCTTCGGCGACCTTGGCCTTGAGAGCGTCTGGCGACTCAAGCAGGTGAAGCACCTCGGTCTGATCCATCTCCAGAAGCATGCCG
GTCACCTTGGCAGCCTGGTCGTGCTCCAGCTGATCAACAAGAGGGTACAAGTTCTCGCCAAGCATCATTCTTTGCGTCTCTGGGGGTGAATTGGCAAGTG
CAGAAGCCAATGCCCCAATTGGAACTGGCTGTGACGCACCGGCATCTCTCATAGGCATCCCTCCCATCTCATATGGGGATGTCATCACACCCCCAACACC
ATGCATAGCAGGATCAGGCATGCCACGGCCGGTCGGATAGCGGTAACCACGACCACCACCCCTACCCATCATCTGCTGCTGACCCATCTGCATGGATTGC
TGCATTCCTCCAGCACCAGCTCGCCTACCAGCTGGGCGTTGTGGTTGTTGTCCTTGCTGAACCATAGGCATCATAAAGTTTGGCATTGGAGCACCACCTG
GCCTCATTCCAGGCATGAAAGGTTGCTGGAAGCCAAATCCAGGCTGTGGGTTAATAAACGCTGGTGGCTGGCCATAGAACATTTGCTGACCAACTGGAAC
ACCAGGAGGTAACATTTGCATACGAGGACCAACAGTTTGAGCCATTGGAACAGGGCGCATTTGTGAAAACTGTGCCTGCAGCCTAGCTTTCCTATCTTCT
TTGCGCTGTGCGAGTGCAACATAAAGTGGTTTATTGCCAACCATCTTGTTGTTCATTTCAGCAAGAGCTCGGGAAGCATCATCAGCAGATTTAAAAGCGA
CAAATCCAGAACCTCTGCTAGCGCCGTTTGAATCACGCATAACCTTGCAGGAAGTAATAGTTCCGAACTCAGCAAAAAGTTCTCGCAACTTTTCATCGTC
AACAGTATCATCCAAGTTCTTCAGATACAAGTTGGTGTTTTGATACTTATCCGCTGCCTCTTGAAGGTTCTTTTCAAACTTCTCTTTCAATTCCATCTCC
CTTTCTGACTTTTTCTGCGCTCTTCCAACATACCATTCCTTGTCACTAAATTTCTTGCCATTCAAATCTTGAACAGCCAGAGCAGCTTCATCTGGACTTT
CGAAATTCACAAATCCAAAACATTTGGATCTTCCATCCCCATCCCGCATTACAACAACACTTGTTATTGCTCCAAACTTCCCAAAGATTTCCTTCAAGTC
ATCTTCAGTGGTAGTCTCAGCTAGGTTCTTAACATAGACATTATTGAACTTGACATTGCCGGGAGAGTTATCTCTCTCCTGCTTACGAACAAAAGGCCCA
ACATACACCTTCTTGTCATTCATAAGCATCCCATTCAGTTTCTCGATAGCAGCATGAGCAGCCTCATCCCGCTCATACTGAACGAAGCCATAGCCCTTTG
ATTCCCCAGCAGGATCTGTTGCAACTTTACATGAAAGAATGTTTCCAAACACACAAAATGTGTCATACAAAGCTTTGTTGTCAATTGACTTGTCAAGATT
CTTAATAAATATATTTGCTGTGCCACTCTTGCGCAAGCTGGGGTCACGGTTAGAATACATTATCCTGATAGGCCTCCCATTGATAGGAGTGAAGTTGAGC
ATTTCAAGAGCCCGTGCAGCGTCGGCCGGGGTGTTGTAGTTGACGTAGGCGTATCCGAGCGACTTCCGCGAGGTGACGTCCCTGCAGACGCGCACGGAGA
CGACGCCGCCGATCTGGGCGAAGACGTCGAAGAGCTGCGCGTCCTGCACGCTCACGTCAAGGTCGCCCACGTACAGCGATGTCGCCGGGAACGACGACGC
CGCCGCTGCAGCCGCAGCGGCCGCCGCGGCCGGGGAGCCGCCCTCCGACGCCGAACTCGCCGCCTGCGCCGCCATCACCGATCGAAGGGTAGATTTTTTT
TCGTGATTTTGCGGATTTTT
page-top