Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14355  (registered. 2003)
Contig Information
Length 669 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit rhodopsin-like receptor [Zea mays] >gi|195657867|gb|ACG48401.1| rhodopsin-like receptor [Zea mays]
Score 78
Evalue 6.30563
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14355
AGGGATCGGCTCCGCCGCCGACGCCGAGAGAGGATGAGCTACCAGCAGGTCCCTCCGCAGGAGTCCTACCCGCCGCCAGGGTATTCGCCGGTGTACCCGC
CGCCGGCCGGCGGGCAGCAGGGCCCGTACTACCCGCCGCAGCAGCAGCAGCCGCCGCCGCCTCCGGGGTACCAGGGATACTTCAGCCAGGGCCAGCCACA
GCAGCCACCGCCCTACTACTACCCGCCCCCGCCGCCGCACAGTGGCCATCACCACCACGGCCACCACCACCATGACCACCACGCCGAGGACCACCACCAC
CACCATGGTCATCATCACCACCACCACCACAACGACGATGACTGCTGCCTTGGCTTCCTCAAAGGATGGTTGGCCGCTCTATGCTGCTGCTGCTGTCTGG
AGGAGTGCTGCTGCTGTTTCTGGTAATGTGCGTGCTTGGAAGCTACTCGTGTCTTGCATGTTCGACATTGGGCATGCCGCAGTATCCAGTGAATCTTCTG
GCTTGTTATTATGTGTAGCTATATGAACTTAGTCTGTTACCTGTGTCAAATAAACTGTGTTTACATTGTTTGCTGAACTGCTTGGGCCATGGATGAACGG
TGTTGTGCAAAGTGTACATGATCCAGACTTGACTGTATTTTATTGGTTGATTGTGGAAACTTGGTGCTG
page-top