Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14339  (registered. 2003)
Contig Information
Length 778 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit Os08g0157600 [Oryza sativa (japonica cultivar-group)] >gi|113623001|dbj|BAF22946.1| Os08g0157600 [Oryza sativa (japonica cultivar-group)]
Score 645
Evalue 1.52605e-65
Total Hit Count 42
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14339
TTTTTTTTTTCACCACACAAAAATAAGCATAATTGCCTTTTACCAATAAAGTAGCATGCGTAGGTGCTTAATGCTTAATTGAGAGTCTAGAAGGGCTGCT
CGGCAAGCATTAACATACAACACATAATAAATTGAGTTCTGTGAAACACTGCATTGCAAGGACTGAGAAGTCCTATAGTAGTAGCTTAGATGTAAATACT
GCAATTTCTTGAAAATACACTACTCGTGAAGGCTGGTAATCATGTCGTAGCAAGTAAATCACGTGGAGGGTTCGCTGTCAAGACGAATCCTCTTGGTACC
AACCTCGTCAGAAGCCGGCACCCTATTCTCCTTTGCTTCCACCGAGCACCTCTTGTAAGGTTTGAAGCCTGTCCGGCGGGATTTCATATTCAGGTGTGAC
AATTCAATGGGAAAGGTAGCAGCTCTTGGCCCAACCAATGTATCAAGTTCATGGTCCATAACTGCAGCACTCTTGTTGAGGTCGACCGTCACCGTAGTAG
CTTCGTCTTGTTCCCCCCTGGGTACCACCTTCAATCCTTCTGCTTGTGGAGGAGAAAAGCTTTGGGGAAGCTTTCCTCTACTGAACAGTTTATCGAAAGC
CATACGACCCTCTTCGGAAACTTCCTTCCATGAATCATTTGTGCTTGAAATGTTCCTAAACCTGCGGTGGTTCATGTCACCANCTGAANAATTACTGCAA
CATGCTTGCTGTGTCTTGTCNNTGGCTTGATCTTGGTTCTCANGAACATGTTCTGCCTCTACATCACTACTTGATGGC
page-top