Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14292  (registered. 2003)
Contig Information
Length 767 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit tropinone reductase 2 [Zea mays]
Score 576
Evalue 1.48142e-57
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14292
TTTTTTTTTTGTTAGTAAAATAGACAAATCTACTTTAGAAATACATTAAAAACTAACAACAATGTAGCAAAATAATTGTACTAGGGGACAACACTCAGGT
GCATGCTAAATACTTGCCACTTTATTATTGAATCTGCATGCAGAAGAGTTTAATCGATAAGACCCTCTTAATAATTAACTACGCACTAATTGTTCGACCA
CCATCAACGGTGATGACTTGGCCGGTGACGAAGGATGCCGCTGGCATGCAGAGGAACGACACCACTGCAGCCACCTCCTCTGGCTCGCCTGCCCGCCGCA
TCGGATTCTTTGCCAACTCGTTCTCTTTAATTTCCGGTGGAACACTGTTTAACATGTCACTCTTGGTCGCGCCCGGGGCGACGCAATTCACCCGGATCTT
GTTATGAGCCCATTCGGTAGCAAGGCTCCTTGTAAGCTGGTTAATTCCTCCTTTTGTCATACTGTAAATCGCGAGGCCCGGGAATCCAAGTGTGCCCCCA
AGGGAGGATATGTTGACGATGCTACCTCCTCCAGCGATGGATGCCCCGAGGAGCAAGGGGTGCGTGAGCTGGCTCAGGTGGAAGCACGACTCTAGGTTGG
TCGCCATGAGGTGCGTGTACTCCTCTGATGTGCACTCCACAGCCGCCTTGGCAACAGCCTGCGCCGCGTTGTTCACCAATATGTCGAGCTTGCCGTCGAA
GACTTGCTTGACCGTCTCCGCGAGCTGCTCCCTGCTGGCGCGCAGGGAGACGTCGCAGACGGAGACG
page-top