Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6769  (registered. 2012)
Contig Information
Length 1065 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XE Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57239851|gb|AAW49219.1|| protein kinase 1 [Aegilops tauschii]
Score 528
Evalue 3.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6769
TTTTTTTTTTGCAAAAAAATAGTAACAAATATATAAACTGCCGAAGCGTAAAGAGAATCAGATCACCAGGAATCCTACTGATGACACCAAACACATATGG
AAGTATATAGTTATACTTATACTTTATCCACAGCATCACTACGAACAACGGTTACAGAAACACATGTAATCATACAACAGCACACCGCAACCCTCTGCAA
CAGACGACACACCAGAAGGATGAACACATTACAAACACAAAGCCACACCACCAAGGGGAACCACACCTGCCCGTCACAACGCGCACACAAAGTCGCCGCT
GTCCTCGACGTCCGCGTCGACGTCGTCTATGTCGTCGAGCTCCATGCTCCCTAGCCCGGGAACCGACAGCTGCCCGGCAAACTTGGATCCGTCGCCCGGT
ATCCGTGCCTCCTGGATGATGGCCATGACCTCCTCCAGGGTCTGCGGGGGAGCGTTGACGCCGACCATATGCAGGCTCATCTGGTACTCGTCGGTCATCT
CGATCGGCAGATTCTTGAGGAACCATGGGTGGTTCTTGATCTCTTGGATGGTTATTCGTTGCTCAGGGTTTGCCACGAAAATCCGGGACAGCAAATGCCT
GCACTCCATTGAAATCCGGACGTAATCGGGTACTGCATATTGTACGCTGAGTATCCGAGTAATTGTCTTGCGGAAATTCTTTGGTTCGTCTGGGTCCTCA
AAAGGATAAGCGCCGACAAGCATCACATATAGGGTTACTCCACACGACCAGACATCAGCGACCTTTCCATCATATTCCCTTCTAGAAAGGACCTCGGGGG
CAATGTAGGCAGGAGTACCGACGGTTGATTTTGGTTGAGAATGCAACACAGAGGACTTGGAGTAACCGAAATCACATATCTTGAGCCGGGGTGCTTCGCT
TCCATCCAGGAGTGTGTTTTCTAGTTTCAGATCTCTATGACATATTTGCATGGAATGGCAATAGCTAACTCCTGAAAGCAATTGTTGGAAGAAGAACCTA
GCCTCATTCTCGCTAAATCTTCCAGAACTGCAGATCCTTTCGAATAGCTCACCGCCAGCAGCGTA
page-top