Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14237  (registered. 2003)
Contig Information
Length 855 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Homology (BLAST) Top Hit Os05g0383000 [Oryza sativa (japonica cultivar-group)] >gi|113578960|dbj|BAF17323.1| Os05g0383000 [Oryza sativa (japonica cultivar-group)] >gi|215717014|dbj|BAG95377.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215764973|dbj|BAG86670.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196704|gb|EEC79131.1| hypothetical protein OsI_19781 [Oryza sativa Indica Group]
Score 580
Evalue 6.26236e-58
Total Hit Count 132
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14237
TTTTTTTTTTGAAATAAGACCCGTGACAGTTCATTTATTGGTGTATACAGCACTAGGTTTGAGACAACGGTACTTCCATAACGATTTGATTTATCCGAAG
ATGCACGGTGCCATGGTATCATAAACTCATTTTATGCACAATAGTTGCGGCGATTCGACTCTAAGTAAAACACAGAACGGACGGTAGAACGGTAGAACCA
AACACACATCCTATTTCGTCAACAGGCGGGTGCAATCTCACTTCTTCCTTGCAAGAGCAGCTGCGATCCCACCAACGATAAGTCCTACCGCAGTTGTGGC
GATTCCTATGCCGATCACACCATCTTTAGCAATTTTATCCTCTATTGCCTTCTTCAGAGATGATGCCTGCCTCCAATCTGGTTGAATCTCCAAACAACGG
TCCGCAAGTTGCCGGCTCCTTACATAGTTACCATTTCTGTAGTGCCCAACAGCCAGCAAATACAGTTTTTCTCTAGTCTGCAGTGGGCTGGTGGTTTTAT
CAAGAGAAGCTTCAATCATGCCAATTCCACGGTTCACATCATCAGTCTGCTTGGAATGGACGAGAGCCCAAGATAGCCTCATAATGCTATCATTTTTCTG
TTCTTCGGTTGCAGCCTCAGCAACCTCTCTTTCACATCCGGCGATGATGTCGCGGTCGCACCAGGGGATGTTGTCGCCGCCGGAGAAGAAGGAGCCCACC
GACTCGAAGAACTTGCTCATCTGCGCCTCCATCGCTCTCGACCGATCTGCTTGGGGATGGGGAGTAGGGGTTTCGATTTTGGGGGAGGAGGCGGTGGCCG
GTGTTGGTGGGTGGACGAGGGTTTCTGGACGCGGAAGGAAGCAGCGTCGTAGTAT
page-top