Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14181  (registered. 2003)
Contig Information
Length 1155 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os04g0526300 [Oryza sativa (japonica cultivar-group)] >gi|38344441|emb|CAE05647.2| OSJNBa0038O10.13 [Oryza sativa (japonica cultivar-group)] >gi|113564933|dbj|BAF15276.1| Os04g0526300 [Oryza sativa (japonica cultivar-group)] >gi|116310962|emb|CAH67898.1| OSIGBa0115K01-H0319F09.4 [Oryza sativa (indica cultivar-group)] >gi|125549090|gb|EAY94912.1| hypothetical protein OsI_16714 [Oryza sativa Indica Group]
Score 1165
Evalue 1.46696e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14181
GCTTGGGCTGTCTGCCGTACAATGTCTTCTTCCTCCTCCATCCCAACCTTTCCGCCGCAAGAGGGCGATGCCGAAACCAACGAGGAGCTCTACGGGCAGT
TCACCGAGCTGGTGTCCTCCTGGCCGTGCTCCCGAGGCCTCTCCAGGGCGAACCAGCTCTACCGCCACGAGAAGGGATGGTACAGCACCCTGCCTCCGAT
GGTCGGCGCGATGGTCGCCGACGCACGCTTCGCCGCGCGCCCCTCGGACATCGTCGTCGCCACCATGCCCAAGTCCGGCACGACGTGGATGAAGGCGCTC
CTCTACTCCACGGTCAACCGGAAGGAGCACCCCCCGGGCGGCCCCGGCCACCCGTTCAACTCCCTCGGCCCGCACGAGTGCATCCGCCACCTGGAGTACC
AGCTCTACACGCGCAACAGGGTCCCGGACCTCGACGGGCTCCCAGACCCGAGGCTCCTCGCCACGCACGTCCCGCTCGCGTCGCTGCCGAGGTCCGTCGC
CGCGTCGGCGTGCAGGATCGTGTACGTGTGCCGCGACCCCAAGGACACCCTGGTCTCGACGTGGACCTTCGTGAACAAGTTCAGGGCCGAGGACGGGCTG
GAGCCGATCTCGGTCGAGACCGCCGCCGACTACTTCTGCGACGGCGTGTCGGCGTCCGGGCCGTACTGGGACCACGCCCTCGGGTACTGGCGCGCGCACC
TGGCGAACCCCGAGCGGGTGCTCTTCTTCAGGTACGAGGAGATGAGTCGGGACCCTGCAGCCCACGTCCGGAGGCTGGCGGAGTTTGTCGGACGCCCGTT
CAGCGCGGAGGAGGAGGAAGATGGCGCGGTGGACGCCGTCGTCAAGCTGTGCTCGTTCGAGCACATGACCGGGCTCGAAGTGACCAAGAGCGGCAAGACG
GAGCTTGTGTTGGGCGCTGTGGAGAACAGCTCGTTCTTCCGGCGCGGCCTGGTCGGGGACTGGGAGAACTATCTGTCGCCGGAGACAGCACGAAAGATCG
ACGCCATTACCGAGGCTAAGTTCAGGGGTTTCGGTCTCTCTGTCTAGCTAGCATTCGGTATCCGCGTGTCATTCAATATTCGCATACGTGTGCCGCTAGT
ATATGTCAACAAGGGAGCGGCATATTGTGTTGATATTTTTATTTGTGGATGAAAT
page-top