Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig14072  (registered. 2003)
Contig Information
Length 487 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit predicted protein [Phaeodactylum tricornutum CCAP 1055/1] >gi|217407641|gb|EEC47577.1| predicted protein [Phaeodactylum tricornutum CCAP 1055/1]
Score 82
Evalue 0.914461
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig14072
GGACAGAATCTGATGGATCGGGGGTCAGAGATTGCGGGGCAGCTGAAAAAGCATGCCCCGGAAATCTTGGGCAGCATCTGCAATGAGGCTATCTTCCAGA
TGAAGATACCATTCATCGGCAGCAAAGAAAGCCAGTTCGAGTTGAAGGACTACTGGTTTAACGACCCCAACAAGTCACTAAGCAGGCTAGAGCAGAGGGC
GAGGCGTGCGTTGGCCATGCGAGAGAAGGACCGGATTCGACGTGAGGAGTTCAAACGTGCTGAGGCGGAAAGGAAACGTGCGGCTGCGCCTCTGTACGAG
CAGTACATGGCCAGGAAGGATTTGAATGGTATGAAGGTGATGGAGCAGCTACGCGAGGAGAGGATGAGGCGGTTGTCGGGGAATATGTAGGACAGGACAC
GTAGACAGCAGCCGGTCTGATAAGCTGTGCGGTCGTGGGTGATGGACCCGGTTTTGACACTGTTGGCAATTGCTGCCAAAAAAAAAA
page-top