Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13909  (registered. 2003)
Contig Information
Length 995 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit unknown [Zea mays]
Score 394
Evalue 2.95768e-36
Total Hit Count 108
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13909
CTTGAAATTTTTTCAGGAATGACACAAAGTACTAGATAATAATTCACGAATTTTAAGGAAAAAACATGAAACACACAGGTAATCAGCAAAATAACACTTC
AACCCACTGACAGACGCTAACCACAAGTTATACATATCGATTCACACAAATAACATAGCACTACAGAGGTGTGCTAATCATGGTTTTAACAACAAAAATA
CAAACTACGGCTAGAAATCCAGCAATGATAAGCATTTTGTTCCATAAAAAATGCCCATGTGTGACTGATCCATAGCAAAATGTTTGTTGTTGAAATAGTT
ACTCTACTAAAACTTCCACCATCAACTTCTTTGAACATTTTTATCGGATAGCTTTAGTAAACCTTATGCTATCTACATCTCAGAAATCTCCTCCTTCAAC
CAATAAAGTCGAAGATTTGAGTCCTTGGTATTGATGAATATTTCTCGATTCATTGGGCATTTGAAAAGCCGCAGTGCCTTTGCTTTTTCTGCAACTGATA
AATCTTCCATTGGTTCTAGCGCAGCCACACAGTTTCCAATCGAGAAAATGTCATCTTGCTTTGATTCCTTCAACTCGTCAACCAGTTTTGCAGACTGTTT
CTTCCGAAAATCCATGTAATCCTCAAGTACAACAGCGATCTGACTTTGCTTCCTCTTTTTGACAGGCAGTGCTCCCTTTTGTTCAGAGTTGGTAGATGTT
GTAGCTTCAGGTTCATCTCTTCTTGATGCCCCTTGCCCTTGTAGATCAGATGAGGACATACCATCATCAACATTGGTAGAGGAGATATAGTTCAAATCAT
TAGTAGAGGAATCCATAGGAGAAATGGCATCGCTTGTGAGATCCACTTGCGGAATTGATACAAAGTTCAAGTCTCCTGAAGCAATACTTCCTTCATGTAG
TGTAGCCAATGACTTGAAGAGCATGAATGGTTTTGAACGGAACTTCTTTACCCTTAGATTATCCTTGATAAGTTTATCCCATATTACAGGTCAGC
page-top