Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13901  (registered. 2003)
Contig Information
Length 916 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit threonine synthase [Zea mays]
Score 1106
Evalue 7.08104e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13901
GGCCTCGTGCCGCTGAGCTGCCCATATACCTCGCAAACTCACTCAACTCGCTTCGGCTGGAGGGGCAGAAGACTGCAGCCATAGAGATATTGCAACAGTT
CAATTGGCAGGTGCCGGACTGGGTCATTATCCCAGGAGGCAATCTGGGCAACATTTATGCTTTCTACAAGGGGTTTGAGATGTGCCGTGCTCTTGGGCTA
GTTGATCGTGTTCCACGGCTTGTATGTGCACAGGCTGCCAATGCAAATCCACTGTACCGGTATTACAAGTCTGGGTGGACTGACTTCCAATCACTTGTTG
CTGGAACTACATTTGCATCTGCCATACAGATTGGTGATCCAGTATCTATTGACCGTGCGGTTGTTGCGCTGAAGGCAACCGATGGCATTGTTGAGGAAGC
TACAGAGGAGGAGCTTATGGATGCGACGGCTCTTGCTGACCTCACTGGGATGTTTGCTTGCCCACATACTGGGGTTGCACTTGCTGCCCTGTTCAAGCTC
CGTGACCAGGGTATAATTGGCACTAATGACCGCACGGTGGTTGTTAGTACAGCACACGGGCTAAAGTTCACACAATCAAAGATCGACTACCATGATAAGA
ACATCAAGGACATGTTGTGCCAGTATGCCAATCCACCGATCAGTGTGAAGCCTGACTTTGGGTCTGTCATGGATGTTCTCCAGAAGAAGCTCAATGGTAA
GATCTGAGCTTACCTTTAATTAACCTCAAGAGTTCTATCTTGTTTATCGTCACAACGGCTGTACTTTGGCATCTTAATCAACTGCACTTGGTGACCATGG
TATGGCGATATCATCTTTATTTTCCAGTACTAGGTTCTTGAGGCTCTTCTAACTATAGGCAAAAGTGGATAGAGCTTTCCTTGTACTTTATCTGTATCAT
GTAATAGCAATAATAA
page-top