Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13804  (registered. 2003)
Contig Information
Length 990 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 4
Homology (BLAST) Top Hit heat shock protein HSP26 [Triticum aestivum] >gi|220675835|emb|CAM12753.1| small heat-shock protein [Triticum aestivum]
Score 993
Evalue 1.02497e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13804
ATTCGTAGCACATCGGCTTCCAAGTTCCAACGATCTCGTAGACACTCTCTCGTTTCAATTCTCGAGCGACTTTTAATCTTTCAAAGTGCAATGGCTGCTG
CGAATGCCCCCTTCGCTCTCAGTCGCCTCTCCCCGGCCGCGCGCCTGCCGATCCGTGCCTGGAGAGCCGCGAGGCCGGCCCCGGTCTGGACCGGGAGAAC
CCGCCCGCTCTCCGTGGCCTCCGCGGCGCAAGAGAATAGGGACAACTCCGTCGACGTCCAAGTCAGCCAGGCCCAGAACGGCGGCAACCAGCAGGGCAAC
GCTGTCCAGCGCCGGCCGCGCCGCGCCGGATTTGACATCTCCCCGTTCGGGCTAGTGGACCCGATGTCGCCGATGAGGACGATGCGGCAGATGCTGGACA
CGATGGACCGGCTGTTCGATGACGCCGTAGGGTTCCCCACGGCGCGGCGCTCGCCGGCGGCGGCTAGCGAGATGCCGCGGATGCCGTGGGACATCATGGA
GGACGACAAGGAGGTGAAGATGCGGTTCGACATGCCCGGGCTGTCGCGGAAGGAGGTGAAGGTGATGGTGGAGGGCGACGCGCTCGTCATCCGCGGCGAG
CACAAGAAGGAGGCCGGCGAAGGGCAGGTCGAAGGCGGCGACGGGTGGTGGAAGGAGCGCAGCGTGAGCTCCTACGACATGCGCCTGGCTCTGCCAGACG
AGTGCGACAAGAGCCAGGTGCGCGCCGAGCTCAAGAACGGCGTGCTGCTCGTGTCCGTGCCCAAGAGGGAGACCGAGCGCAAGGTCATCGACGTGCAGGT
CCAGTGATGAGTGTGTGTGAGACTCTACCCAGTACCCTGCATCTGAGGCTTTAAGATTTCAGCTGTCCGAGGTGTGACCGTGCGAGTGCGTGCTCTTTGT
AGGCGTAGTGTGCCGTTCTTCTCCGATCCTCTCTGCGCGCACGTTGCGCAGAACATGTCGTGCTGTATGTAAATGTACTTGGCAAATCTA
page-top