Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig13638  (registered. 2003)
Contig Information
Length 653 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_09630 [Oryza sativa Indica Group]
Score 312
Evalue 4.33425e-27
Total Hit Count 268
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig13638
TTTTTTTTTTATATCTCAATATCAATTCACATGGTTGTTTGCCAAAAACAATAGTTGTAGTACTGGTTACAAGGATTCAAATGTGGAAGCGGAACGGTTC
CACAACTCACGAAAAATAACAACGGAGTACGGATCGAAAGCAAATCTTATTCGGCGCCAGTGAGCAGTACGCGTCCGTTAATGGGCCGGGCAAGTGAACT
CGGACGGGCACGTCTTGCCGCAGTGGTTGAGGAGGAGGCTGATGTCCACAGGCACGTTGAGGTGGATGCCGAGTACGTTTGCCCTGACGGCGGTGCAGAG
GCAGACGACGGCGTCAAGGTCGGCCAACCCCTGGAGCAGCGGGCAGCACTGGTCGCGCGCCGGAACGCCGATCTTGAGGCCGAGCAGTCCACCGAGAACG
TTGGCGCACACCCTCAGGTTGAGCACGTTGATGGAGCACTGCCCTCCGTGGCCGTGGCCGTGGCCGTGCCCTCCTCCTCCATGGTATGGCGGCGGAACGA
CGACGGGTGGTGTCGGCACGACGACCGGCGGTTGGCAATANGTGCTTCCGCANCCGTTGGCGGCGACGGCGGANANGANGANGCTCANCNCNACNAANAT
GNCANCTTTGCATGCCATTGTGATTGTGTGNTGTGCTANANTANTATANCCTC
page-top