Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6706  (registered. 2012)
Contig Information
Length 1514 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115470825|ref|NP_001059011.1|| Os07g0175100 [Oryza sativa (japonica cultivar-group)]
Score 670
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig6706
GGTTGGAAGGCGGCGGCAGGATAGAGGAGAGGAGTCAGAAGATGGCTCCGGTGAAGAAGCCCAAAAAGGCCAAGCGGAAGATCAGTGACTCCGGCGAGAC
CAAGATCGATGACTCCAGCGAGGCGAAGACCAAGGACGCCAGCAAGGTCAAGAGAACCAAGTCCGGCGGCTCGTTGGCGTTGCTTCCGGCGGACCTTCGT
GGCCCCGATACGGAATGGTGGTATGTCTTCCTCAGCAAGCACGGGGAACTCCACAAGGAAGCCGAATCAGGTGGTCGTGCTCCAGTGCCTTCAGATGATG
AGGAAGCGTTCAGGTACTTCTTCAGGACATCGAGGAGGACTTTTGAGTACATCTGCTCGATTGTACGGGAGGATTTGATATCGAGGCCGCCTTCTGGGCT
GATCAACATTGAGGGGAGACTGCTTAGTGTGGAGAAGCAAGTAGCAATTGCCATGAGGAGGCTGGCATCTGGGGATTCGCAGGTGTCCGTTGGAGCTGCT
TTTGGTGTGGGGCAGTCTACTGTTTCCCAAGTCACATGGAGGTTTATCGAGTCGATGGAAGAGAGGGCTCGGCATCATTTGGTGTGGCCGGGCCAGGAGA
GGATGGAGGAGATCAAAGCTAGGTTGGAGGCTGTCTCTGGTCTACCGAATTGCTGCGGTGCCATTGATGCCACACACATTATCATGACGCTTCCTGCTGT
TGAGTCATCTGAAGACTGGTGTGACCCTGCGAAAAACTACAGTATGTTCCTACAAGGTATTGTTGACGATGAGATGAGATTTATTGATATTGTCACCGGT
TGGCCAGGGAGCATGACATTCTCACGCTTGTTAAAATGCTCTGGGTTTTACAAGCTCTGTGAGGCTGGAAAACGCTTGAATGGTCCTGTCAGAACTTCAG
GGGAGGATTCAGAAATAAGGGAGTTCATTGTTGGTGACATGTGTTATCCTCTACTGCCATGGCTTATGACTCCATACCAAGGAGAAAGTCTATCTACCCC
AATGGTCAACTTTAATGCCCGGCAAAAAACTGCAAGGATGCTTGGAACAAGAGCATTGGCACGGCTGAAAGGCTCCTGGAAGATCTTGCACAAAGTCATG
TGGAGGCCTGATAAAAATAAGTTACCGAGTATCATCCTGGTGTGCTGCCTGCTTCACAATATAATTCTGGACTGCAACGACAAACTGCTTCTGGATATTC
AGCTTCCAGATCATCATGATAATGGTTATAACGAAGAGAACTGCCAGCAAGAGAATCCTAATGGCAAAGTAATTAGAGAGATCATTACAGGATATCTCCC
AACTTATGAAGCAACATCAAACTGAATTAAGCTGGATGGAAGCATAGTTGGAGATGTGATGATGTGCCTTTGTTCTATTGTTATTTACCTCAGTTATCCC
TAATGTTCATGTTCTAGTTTAATCAGATCTGCTGAGTTAATTTTGAGTTAATTTTTCCTGATGATGACAGTCCCTATCATGTTGAGTTTCATAATGTTGC
TGAGGCCAGTTGTG
page-top